EMAIL THIS PAGE TO A FRIEND

BABAM1

BRISC and BRCA1 A complex member 1

65 Gene Product Result for
Synonyms: C19orf62 MERIT40 NBA1
UniProtKB ID: Q9NWV8, A8MQT0, B4DRY9, B4DVR1, Q6FIA0, Q9P018
Gene ID:
Mouse(68251) BRISC and BRCA1 A complex member 1
Rat(290631) BRISC and BRCA1 A complex member 1
Zebrafish(445296) BRISC and BRCA1 A complex member 1
cow(504517) BRISC and BRCA1 A complex member 1
domestic cat(101096041) BRISC and BRCA1 A complex member 1
dog(476676) BRISC and BRCA1 A complex member 1
chicken(776677) BRISC and BRCA1 A complex member 1
naked mole-rat(101720805) BRISC and BRCA1 A complex member 1
domestic guinea pig(100732454) BRISC and BRCA1 A complex member 1
sheep(101113145) BRISC and BRCA1 A complex member 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA068786 Anti-BABAM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA054386 Anti-BABAM1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
SAB2100269 Anti-C19ORF62 antibody produced in rabbit affinity isolated antibody bovine, rat, canine, human, mouse, guinea pig, horse
western blot pricing
SAB1306779 ANTI-HSPC142 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing
GW22374A Anti-HSPC142 antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1409149 Anti-HSPC142 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1307135 ANTI-HSPC142(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2702274 Monoclonal Anti-C19orf62 antibody produced in mouse clone GT1251, affinity isolated antibody human
western blot pricing
SAB2702275 Monoclonal Anti-C19orf62 antibody produced in mouse clone GT2810, affinity isolated antibody human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026636 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026636 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026636 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014173 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014173 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014173 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033549 Rosetta Predictions human pricing
NM_014173 Rosetta Predictions human pricing
NM_001006964 Rosetta Predictions rat pricing
NM_026636 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033549 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00185308 predicted 729
2 SASI_Hs01_00185309 predicted 538
3 SASI_Hs01_00185310 predicted 932
4 SASI_Hs02_00308039 predicted 1156
5 SASI_Hs01_00185311 predicted 410
6 SASI_Hs01_00185312 predicted 1152
7 SASI_Hs01_00185313 predicted 688
8 SASI_Hs01_00185314 predicted 863
9 SASI_Hs01_00185315 predicted 588
10 SASI_Hs01_00185317 predicted 923
11 SASI_Hs01_00185316 predicted 1131
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014173 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033418 predicted 694
2 SASI_Hs01_00033419 predicted 494
3 SASI_Hs01_00033420 predicted 892
4 SASI_Hs02_00345180 predicted 1117
5 SASI_Hs01_00033421 predicted 372
6 SASI_Hs01_00033422 predicted 1112
7 SASI_Hs01_00033423 predicted 650
8 SASI_Hs01_00033424 predicted 832
9 SASI_Hs01_00033425 predicted 547
10 SASI_Hs01_00033427 predicted 890
11 SASI_Hs01_00033426 predicted 1086
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006964 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00048392 predicted 1021
2 SASI_Rn01_00048393 predicted 619
3 SASI_Rn01_00048394 predicted 909
4 SASI_Rn01_00048395 predicted 481
5 SASI_Rn01_00048396 predicted 974
6 SASI_Rn01_00048397 predicted 886
7 SASI_Rn01_00048398 predicted 508
8 SASI_Rn01_00048399 predicted 728
9 SASI_Rn01_00048400 predicted 1020
10 SASI_Rn01_00048401 predicted 593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026636 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172122 predicted 1036
2 SASI_Mm01_00172123 predicted 745
3 SASI_Mm01_00172124 predicted 638
4 SASI_Mm01_00172125 predicted 802
5 SASI_Mm01_00172126 predicted 926
6 SASI_Mm01_00172127 predicted 985
7 SASI_Mm01_00172128 predicted 533
8 SASI_Mm02_00330622 predicted 803
9 SASI_Mm01_00172129 predicted 1085
10 SASI_Mm01_00172130 predicted 1050
11 SASI_Mm01_00172131 predicted 597
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026636
VALIDATED
BABAM1 MISSION shRNA Bacterial Glycerol Stock
BRISC and BRCA1 A complex member 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026636.1-923s1c1
Sequence:CCGGCCAGTGTCCCTACTTCTTCTTCTCGAGAAGAAGAAGTAGGGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-610s21c1
Sequence:CCGGTTCGCACAAAGCACAAGATTGCTCGAGCAATCTTGTGCTTTGTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-257s21c1
Sequence:CCGGAGAAGGAGAGGAGCCGATATCCTCGAGGATATCGGCTCCTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-937s21c1
Sequence:CCGGTCTTCTTCGACATCGTTTATACTCGAGTATAAACGATGTCGAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-1206s21c1
Sequence:CCGGACTATGACATGTGACATCTCCCTCGAGGGAGATGTCACATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026636.1-600s1c1
Sequence:CCGGGAGATGTTTGTTCGCACAAAGCTCGAGCTTTGTGCGAACAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026636.1-500s1c1
Sequence:CCGGGATCATCTGTCTGGATCTTTCCTCGAGGAAAGATCCAGACAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-500s21c1
Sequence:CCGGGATCATCTGTCTGGATCTTTCCTCGAGGAAAGATCCAGACAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026636
VALIDATED
BABAM1 MISSION shRNA shRNA Plasmid DNA
BRISC and BRCA1 A complex member 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026636.1-923s1c1
Sequence:CCGGCCAGTGTCCCTACTTCTTCTTCTCGAGAAGAAGAAGTAGGGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-610s21c1
Sequence:CCGGTTCGCACAAAGCACAAGATTGCTCGAGCAATCTTGTGCTTTGTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-257s21c1
Sequence:CCGGAGAAGGAGAGGAGCCGATATCCTCGAGGATATCGGCTCCTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-937s21c1
Sequence:CCGGTCTTCTTCGACATCGTTTATACTCGAGTATAAACGATGTCGAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-1206s21c1
Sequence:CCGGACTATGACATGTGACATCTCCCTCGAGGGAGATGTCACATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026636.1-600s1c1
Sequence:CCGGGAGATGTTTGTTCGCACAAAGCTCGAGCTTTGTGCGAACAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026636.1-500s1c1
Sequence:CCGGGATCATCTGTCTGGATCTTTCCTCGAGGAAAGATCCAGACAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-500s21c1
Sequence:CCGGGATCATCTGTCTGGATCTTTCCTCGAGGAAAGATCCAGACAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026636
VALIDATED
BABAM1 MISSION shRNA Lentiviral Transduction Particles
BRISC and BRCA1 A complex member 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190336    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026636.1-923s1c1
Sequence:CCGGCCAGTGTCCCTACTTCTTCTTCTCGAGAAGAAGAAGTAGGGACACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-610s21c1
Sequence:CCGGTTCGCACAAAGCACAAGATTGCTCGAGCAATCTTGTGCTTTGTGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-257s21c1
Sequence:CCGGAGAAGGAGAGGAGCCGATATCCTCGAGGATATCGGCTCCTCTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-937s21c1
Sequence:CCGGTCTTCTTCGACATCGTTTATACTCGAGTATAAACGATGTCGAAGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-1206s21c1
Sequence:CCGGACTATGACATGTGACATCTCCCTCGAGGGAGATGTCACATGTCATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026636.1-600s1c1
Sequence:CCGGGAGATGTTTGTTCGCACAAAGCTCGAGCTTTGTGCGAACAAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217510    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026636.1-500s1c1
Sequence:CCGGGATCATCTGTCTGGATCTTTCCTCGAGGAAAGATCCAGACAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_026636.1-500s21c1
Sequence:CCGGGATCATCTGTCTGGATCTTTCCTCGAGGAAAGATCCAGACAGATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014173
VALIDATED
BABAM1 MISSION shRNA Bacterial Glycerol Stock
BRISC and BRCA1 A complex member 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014173.1-856s1c1
Sequence:CCGGGACGTTGTTTACATCCACAATCTCGAGATTGTGGATGTAAACAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014173.1-944s1c1
Sequence:CCGGCAAGGGTACCAGCTACAAGTACTCGAGTACTTGTAGCTGGTACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014173.1-431s1c1
Sequence:CCGGCAGAGGAAATGTCACTGCCAACTCGAGTTGGCAGTGACATTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-1141s21c1
Sequence:CCGGAGGAAGTCCTTGGCCTAAAGCCTCGAGGCTTTAGGCCAAGGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014173.2-893s21c1
Sequence:CCGGATGAGTTGGAAGGATATGTTTCTCGAGAAACATATCCTTCCAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-838s21c1
Sequence:CCGGTTTCTTCTTTGACGTTGTTTACTCGAGTAAACAACGTCAAAGAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-389s21c1
Sequence:CCGGTGTCCAGAGAAAGTGATTATCCTCGAGGATAATCACTTTCTCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-645s21c1
Sequence:CCGGCCTCCTGTTCCACCTTCAATCCTCGAGGATTGAAGGTGGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014173
VALIDATED
BABAM1 MISSION shRNA shRNA Plasmid DNA
BRISC and BRCA1 A complex member 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014173.1-856s1c1
Sequence:CCGGGACGTTGTTTACATCCACAATCTCGAGATTGTGGATGTAAACAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014173.1-944s1c1
Sequence:CCGGCAAGGGTACCAGCTACAAGTACTCGAGTACTTGTAGCTGGTACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014173.1-431s1c1
Sequence:CCGGCAGAGGAAATGTCACTGCCAACTCGAGTTGGCAGTGACATTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-1141s21c1
Sequence:CCGGAGGAAGTCCTTGGCCTAAAGCCTCGAGGCTTTAGGCCAAGGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014173.2-893s21c1
Sequence:CCGGATGAGTTGGAAGGATATGTTTCTCGAGAAACATATCCTTCCAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-838s21c1
Sequence:CCGGTTTCTTCTTTGACGTTGTTTACTCGAGTAAACAACGTCAAAGAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-389s21c1
Sequence:CCGGTGTCCAGAGAAAGTGATTATCCTCGAGGATAATCACTTTCTCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-645s21c1
Sequence:CCGGCCTCCTGTTCCACCTTCAATCCTCGAGGATTGAAGGTGGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014173
VALIDATED
BABAM1 MISSION shRNA Lentiviral Transduction Particles
BRISC and BRCA1 A complex member 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014173.1-856s1c1
Sequence:CCGGGACGTTGTTTACATCCACAATCTCGAGATTGTGGATGTAAACAACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014173.1-944s1c1
Sequence:CCGGCAAGGGTACCAGCTACAAGTACTCGAGTACTTGTAGCTGGTACCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014173.1-431s1c1
Sequence:CCGGCAGAGGAAATGTCACTGCCAACTCGAGTTGGCAGTGACATTTCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-1141s21c1
Sequence:CCGGAGGAAGTCCTTGGCCTAAAGCCTCGAGGCTTTAGGCCAAGGACTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014173.2-893s21c1
Sequence:CCGGATGAGTTGGAAGGATATGTTTCTCGAGAAACATATCCTTCCAACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-838s21c1
Sequence:CCGGTTTCTTCTTTGACGTTGTTTACTCGAGTAAACAACGTCAAAGAAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-389s21c1
Sequence:CCGGTGTCCAGAGAAAGTGATTATCCTCGAGGATAATCACTTTCTCTGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014173.2-645s21c1
Sequence:CCGGCCTCCTGTTCCACCTTCAATCCTCGAGGATTGAAGGTGGAACAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks