EMAIL THIS PAGE TO A FRIEND

BACE1

beta-site APP-cleaving enzyme 1

314 Gene Product Result for
Synonyms: ASP2 BACE HSPC104
Gene ID:
Human(23621) Summary: Cerebral deposition of amyloid beta peptide is an early and critical feature of Alzheimer's disease. Amyloid beta peptide is generated by proteolytic cleavage of amyloid precursor protein (APP) by two proteases, one of which is the protein encoded by this gene. The encoded protein, a member of the peptidase A1 protein family, is a type I integral membrane glycoprotein and aspartic protease that is found mainly in the Golgi. Multiple transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, May 2011]
Mouse(23821) beta-site APP cleaving enzyme 1
Rat(29392) beta-site APP cleaving enzyme 1
Zebrafish(403005) beta-site APP-cleaving enzyme 1
cow(614333) beta-site APP-cleaving enzyme 1
Horse(100071137) beta-site APP-cleaving enzyme 1
domestic cat(101086840) beta-site APP-cleaving enzyme 1
dog(489390) beta-site APP-cleaving enzyme 1
chicken(419768) beta-site APP-cleaving enzyme 1
sheep(101119667) beta-site APP-cleaving enzyme 1
Domestic Rabbit(100343442) beta-site APP-cleaving enzyme 1
naked mole-rat(101701890) beta-site APP-cleaving enzyme 1
domestic guinea pig(100135485) beta-site APP cleaving enzyme 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1306046 ANTI-BACE (S498) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
western blot pricing
B0806 Anti-BACE 1, C-Terminus (485-501) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
microarray, western blot pricing
B0681 Anti-BACE 1, N-Terminus (46-62) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB3500240 Anti-BACE antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
ELISA, immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
SAB4501017 Anti-BACE, C-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry pricing
SAB2900193 Anti-BACE1 (AB1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2900194 Anti-BACE1 (AB2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry pricing
SAB2108415 Anti-BACE1 antibody produced in rabbit affinity isolated antibody guinea pig, mouse, horse, human, rabbit
western blot pricing
SAB2900206 Anti-BACE1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution rat, mouse, bovine, human, pig, rabbit, horse, monkey, guinea pig, hamster, dog
immunohistochemistry pricing
SAB2100200 Anti-BACE1 antibody produced in rabbit affinity isolated antibody rabbit, rat, guinea pig, bovine, horse, human, zebrafish, mouse
western blot pricing
SAB2106747 Anti-BACE1 antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, human, rabbit, horse
ELISA, western blot pricing
SAB1306299 ANTI-PHOSPHO-BACE(S498) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0623 Human BACE1 / Beta-secretase 1 ELISA Kit human pricing

Activity Assay

Product # Description Species Add to Cart
 
CS1060 SensiZyme BACE1 Activity Assay Kit sufficient for 96 multiwell tests human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012104 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012104 siRNAs that have been validated in the lab human pricing
NM_138971 Rosetta Predictions human pricing
NM_138972 Rosetta Predictions human pricing
NM_138973 Rosetta Predictions human pricing
NM_019204 Rosetta Predictions rat pricing
NM_011792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012104 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126124 validated 1643
1 SASI_Hs01_00126126 validated 1488
1 SASI_Hs01_00126129 validated 2191
2 SASI_Hs01_00126125 predicted 1624
3 SASI_Hs01_00126127 predicted 1662
4 SASI_Hs01_00126128 predicted 1493
5 SASI_Hs01_00126130 predicted 2217
6 SASI_Hs01_00126131 predicted 2208
7 SASI_Hs01_00126132 predicted 1918
8 SASI_Hs01_00126133 predicted 1803
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138971 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237895 predicted 1511
2 SASI_Hs01_00237896 predicted 1501
3 SASI_Hs01_00237897 predicted 1355
4 SASI_Hs01_00237899 predicted 1528
5 SASI_Hs01_00237900 predicted 1360
6 SASI_Hs01_00237901 predicted 2053
7 SASI_Hs01_00237902 predicted 2084
8 SASI_Hs01_00237903 predicted 2076
9 SASI_Hs01_00237904 predicted 1795
10 SASI_Hs02_00364021 predicted 1673
11 SASI_Hs01_00237898 predicted 1899
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138972 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134579 predicted 1565
2 SASI_Hs01_00134580 predicted 1555
3 SASI_Hs01_00134581 predicted 1406
4 SASI_Hs01_00134583 predicted 1582
5 SASI_Hs01_00134584 predicted 1421
6 SASI_Hs01_00134585 predicted 2116
7 SASI_Hs01_00134586 predicted 2141
8 SASI_Hs01_00134587 predicted 2132
9 SASI_Hs01_00134588 predicted 1852
10 SASI_Hs02_00364022 predicted 1731
11 SASI_Hs01_00134582 predicted 1957
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138973 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00112504 predicted 1435
2 SASI_Hs01_00112505 predicted 1424
3 SASI_Hs01_00112506 predicted 1271
4 SASI_Hs01_00112507 predicted 1446
5 SASI_Hs01_00112508 predicted 1283
6 SASI_Hs01_00112509 predicted 1979
7 SASI_Hs01_00112510 predicted 2012
8 SASI_Hs01_00112511 predicted 1999
9 SASI_Hs01_00112512 predicted 1714
10 SASI_Hs01_00112513 predicted 1593
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019204 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098892 predicted 1620
2 SASI_Rn02_00262037 predicted 1765
3 SASI_Rn01_00098893 predicted 1780
4 SASI_Rn01_00098894 predicted 1459
5 SASI_Rn01_00098895 predicted 1593
6 SASI_Rn01_00098896 predicted 1779
7 SASI_Rn01_00098897 predicted 1475
8 SASI_Rn01_00098898 predicted 1613
9 SASI_Rn01_00098900 predicted 1124
10 SASI_Rn02_00262038 predicted 1231
11 SASI_Rn01_00098899 predicted 914
12 SASI_Rn01_00098901 predicted 1144
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00074076 predicted 1255
2 SASI_Mm01_00074078 predicted 1639
3 SASI_Mm01_00074079 predicted 1387
4 SASI_Mm01_00074080 predicted 1240
5 SASI_Mm01_00074081 predicted 1630
6 SASI_Mm01_00074082 predicted 1612
7 SASI_Mm01_00074083 predicted 934
8 SASI_Mm01_00074084 predicted 795
9 SASI_Mm01_00074085 predicted 1141
10 SASI_Mm02_00321447 predicted 1797
11 SASI_Mm01_00074077 predicted 1468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011792
VALIDATED
BACE1 MISSION shRNA Bacterial Glycerol Stock
beta-site APP-cleaving enzyme 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-1213s21c1
Sequence:CCGGTGGTATCGACCACTCGCTATACTCGAGTATAGCGAGTGGTCGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-2498s21c1
Sequence:CCGGCAAGCCTACACTGGTACAAAGCTCGAGCTTTGTACCAGTGTAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-1719s21c1
Sequence:CCGGATCGAGCCCGAAAGCGAATTGCTCGAGCAATTCGCTTTCGGGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011792.5-985s21c1
Sequence:CCGGCATCACTGAATCGGACAAGTTCTCGAGAACTTGTCCGATTCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-1687s21c1
Sequence:CCGGCGTCATCATGGAAGGTTTCTACTCGAGTAGAAACCTTCCATGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011792.3-3860s1c1
Sequence:CCGGCCCATTTCTTTAGCAGGGCAACTCGAGTTGCCCTGCTAAAGAAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-932s1c1
Sequence:CCGGCATCACTGAATCGGACAAGTTCTCGAGAACTTGTCCGATTCAGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-1735s1c1
Sequence:CCGGCAGTGGAAGGTCCGTTTGTTACTCGAGTAACAAACGGACCTTCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-1634s1c1
Sequence:CCGGCGTCATCATGGAAGGTTTCTACTCGAGTAGAAACCTTCCATGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-1242s1c1
Sequence:CCGGCGTGTGGAAATCAATGGTCAACTCGAGTTGACCATTGATTTCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011792
VALIDATED
BACE1 MISSION shRNA shRNA Plasmid DNA
beta-site APP-cleaving enzyme 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-1213s21c1
Sequence:CCGGTGGTATCGACCACTCGCTATACTCGAGTATAGCGAGTGGTCGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-2498s21c1
Sequence:CCGGCAAGCCTACACTGGTACAAAGCTCGAGCTTTGTACCAGTGTAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-1719s21c1
Sequence:CCGGATCGAGCCCGAAAGCGAATTGCTCGAGCAATTCGCTTTCGGGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011792.5-985s21c1
Sequence:CCGGCATCACTGAATCGGACAAGTTCTCGAGAACTTGTCCGATTCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-1687s21c1
Sequence:CCGGCGTCATCATGGAAGGTTTCTACTCGAGTAGAAACCTTCCATGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011792.3-3860s1c1
Sequence:CCGGCCCATTTCTTTAGCAGGGCAACTCGAGTTGCCCTGCTAAAGAAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-932s1c1
Sequence:CCGGCATCACTGAATCGGACAAGTTCTCGAGAACTTGTCCGATTCAGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-1735s1c1
Sequence:CCGGCAGTGGAAGGTCCGTTTGTTACTCGAGTAACAAACGGACCTTCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-1634s1c1
Sequence:CCGGCGTCATCATGGAAGGTTTCTACTCGAGTAGAAACCTTCCATGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-1242s1c1
Sequence:CCGGCGTGTGGAAATCAATGGTCAACTCGAGTTGACCATTGATTTCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011792
VALIDATED
BACE1 MISSION shRNA Lentiviral Transduction Particles
beta-site APP-cleaving enzyme 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321080    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-1213s21c1
Sequence:CCGGTGGTATCGACCACTCGCTATACTCGAGTATAGCGAGTGGTCGATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321081    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-2498s21c1
Sequence:CCGGCAAGCCTACACTGGTACAAAGCTCGAGCTTTGTACCAGTGTAGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321082    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-1719s21c1
Sequence:CCGGATCGAGCCCGAAAGCGAATTGCTCGAGCAATTCGCTTTCGGGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011792.5-985s21c1
Sequence:CCGGCATCACTGAATCGGACAAGTTCTCGAGAACTTGTCCGATTCAGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_011792.5-1687s21c1
Sequence:CCGGCGTCATCATGGAAGGTTTCTACTCGAGTAGAAACCTTCCATGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009492    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011792.3-3860s1c1
Sequence:CCGGCCCATTTCTTTAGCAGGGCAACTCGAGTTGCCCTGCTAAAGAAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-932s1c1
Sequence:CCGGCATCACTGAATCGGACAAGTTCTCGAGAACTTGTCCGATTCAGTGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-1735s1c1
Sequence:CCGGCAGTGGAAGGTCCGTTTGTTACTCGAGTAACAAACGGACCTTCCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-1634s1c1
Sequence:CCGGCGTCATCATGGAAGGTTTCTACTCGAGTAGAAACCTTCCATGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009493    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_011792.3-1242s1c1
Sequence:CCGGCGTGTGGAAATCAATGGTCAACTCGAGTTGACCATTGATTTCCACACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012104
VALIDATED
BACE1 MISSION shRNA Bacterial Glycerol Stock
beta-site APP-cleaving enzyme 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000272931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-2200s21c1
Sequence:CCGGCTCTTGGTCACCTCAAATTTACTCGAGTAAATTTGAGGTGACCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1153s21c1
Sequence:CCGGTCGGAGGGAGCATGATCATTGCTCGAGCAATGATCATGCTCCCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1606s21c1
Sequence:CCGGAGTTTGCCATCTCACAGTCATCTCGAGATGACTGTGAGATGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1659s21c1
Sequence:CCGGGAGGGCTTCTACGTTGTCTTTCTCGAGAAAGACAACGTAGAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1633s21c1
Sequence:CCGGGCACTGTTATGGGAGCTGTTACTCGAGTAACAGCTCCCATAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-3455s1c1
Sequence:CCGGCCAAGTTCATTACCTCCCTATCTCGAGATAGGGAGGTAATGAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1618s1c1
Sequence:CCGGGCACTGTTATGGGAGCTGTTACTCGAGTAACAGCTCCCATAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1591s1c1
Sequence:CCGGAGTTTGCCATCTCACAGTCATCTCGAGATGACTGTGAGATGGCAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1619s1c1
Sequence:CCGGCACTGTTATGGGAGCTGTTATCTCGAGATAACAGCTCCCATAACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000000277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1644s1c1
Sequence:CCGGGAGGGCTTCTACGTTGTCTTTCTCGAGAAAGACAACGTAGAAGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012104
VALIDATED
BACE1 MISSION shRNA shRNA Plasmid DNA
beta-site APP-cleaving enzyme 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000272931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-2200s21c1
Sequence:CCGGCTCTTGGTCACCTCAAATTTACTCGAGTAAATTTGAGGTGACCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1153s21c1
Sequence:CCGGTCGGAGGGAGCATGATCATTGCTCGAGCAATGATCATGCTCCCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1606s21c1
Sequence:CCGGAGTTTGCCATCTCACAGTCATCTCGAGATGACTGTGAGATGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1659s21c1
Sequence:CCGGGAGGGCTTCTACGTTGTCTTTCTCGAGAAAGACAACGTAGAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1633s21c1
Sequence:CCGGGCACTGTTATGGGAGCTGTTACTCGAGTAACAGCTCCCATAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-3455s1c1
Sequence:CCGGCCAAGTTCATTACCTCCCTATCTCGAGATAGGGAGGTAATGAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1618s1c1
Sequence:CCGGGCACTGTTATGGGAGCTGTTACTCGAGTAACAGCTCCCATAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1591s1c1
Sequence:CCGGAGTTTGCCATCTCACAGTCATCTCGAGATGACTGTGAGATGGCAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1619s1c1
Sequence:CCGGCACTGTTATGGGAGCTGTTATCTCGAGATAACAGCTCCCATAACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000000277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1644s1c1
Sequence:CCGGGAGGGCTTCTACGTTGTCTTTCTCGAGAAAGACAACGTAGAAGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012104
VALIDATED
BACE1 MISSION shRNA Lentiviral Transduction Particles
beta-site APP-cleaving enzyme 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000272931    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-2200s21c1
Sequence:CCGGCTCTTGGTCACCTCAAATTTACTCGAGTAAATTTGAGGTGACCAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1153s21c1
Sequence:CCGGTCGGAGGGAGCATGATCATTGCTCGAGCAATGATCATGCTCCCTCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272868    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1606s21c1
Sequence:CCGGAGTTTGCCATCTCACAGTCATCTCGAGATGACTGTGAGATGGCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1659s21c1
Sequence:CCGGGAGGGCTTCTACGTTGTCTTTCTCGAGAAAGACAACGTAGAAGCCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 2 Clone ID:NM_012104.3-1633s21c1
Sequence:CCGGGCACTGTTATGGGAGCTGTTACTCGAGTAACAGCTCCCATAACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000276    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-3455s1c1
Sequence:CCGGCCAAGTTCATTACCTCCCTATCTCGAGATAGGGAGGTAATGAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1618s1c1
Sequence:CCGGGCACTGTTATGGGAGCTGTTACTCGAGTAACAGCTCCCATAACAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1591s1c1
Sequence:CCGGAGTTTGCCATCTCACAGTCATCTCGAGATGACTGTGAGATGGCAAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1619s1c1
Sequence:CCGGCACTGTTATGGGAGCTGTTATCTCGAGATAACAGCTCCCATAACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000000277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_012104.x-1644s1c1
Sequence:CCGGGAGGGCTTCTACGTTGTCTTTCTCGAGAAAGACAACGTAGAAGCCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks