EMAIL THIS PAGE TO A FRIEND

BACE2

beta-site APP-cleaving enzyme 2

106 Gene Product Result for
Synonyms: AEPLC ALP56 ASP1 ASP21 BAE2 CEAP1 DRAP
Gene ID:
Human(25825) Summary: This gene encodes an integral membrane glycoprotein that functions as an aspartic protease. The encoded protein cleaves amyloid precursor protein into amyloid beta peptide, which is a critical step in the etiology of Alzheimer's disease and Down syndrome. The protein precursor is further processed into an active mature peptide. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Mouse(56175) beta-site APP-cleaving enzyme 2
Rat(288227) beta-site APP-cleaving enzyme 2
chicken(418526) beta-site APP-cleaving enzyme 2
dog(478418) beta-site APP-cleaving enzyme 2
cow(534774) beta-site APP-cleaving enzyme 2
domestic cat(101096756) beta-site APP-cleaving enzyme 2
domestic guinea pig(100720853) beta-site APP-cleaving enzyme 2
naked mole-rat(101717943) beta-site APP-cleaving enzyme 2
sheep(101102027) beta-site APP-cleaving enzyme 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019517 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019517 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019517 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012105 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012105 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012105 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012105 siRNAs that have been validated in the lab human pricing
NM_138991 Rosetta Predictions human pricing
NM_138992 Rosetta Predictions human pricing
NM_001002802 Rosetta Predictions rat pricing
XM_579078 Rosetta Predictions rat pricing
NM_019517 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012105 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113956 validated 1081
1 SASI_Hs01_00113957 validated 761
2 SASI_Hs01_00113955 predicted 2463
3 SASI_Hs02_00343628 predicted 1996
4 SASI_Hs01_00113958 predicted 1039
5 SASI_Hs01_00113959 predicted 958
6 SASI_Hs01_00113960 predicted 1052
7 SASI_Hs01_00113961 predicted 2447
8 SASI_Hs01_00113964 predicted 1190
9 SASI_Hs02_00343629 predicted 2453
10 SASI_Hs01_00113962 predicted 851
11 SASI_Hs01_00113963 predicted 874
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138991 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204928 predicted 2312
2 SASI_Hs01_00204929 predicted 1083
3 SASI_Hs01_00204930 predicted 762
4 SASI_Hs02_00364028 predicted 1851
5 SASI_Hs01_00204931 predicted 1041
6 SASI_Hs01_00204932 predicted 952
7 SASI_Hs01_00204933 predicted 1051
8 SASI_Hs01_00204934 predicted 2301
9 SASI_Hs01_00204937 predicted 1186
10 SASI_Hs02_00364029 predicted 2309
11 SASI_Hs01_00204935 predicted 852
12 SASI_Hs01_00204936 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138992 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167225 predicted 1085
2 SASI_Hs02_00364030 predicted 1200
3 SASI_Hs02_00364031 predicted 1823
4 SASI_Hs01_00167226 predicted 765
5 SASI_Hs02_00364032 predicted 1832
6 SASI_Hs01_00167227 predicted 1042
7 SASI_Hs01_00167228 predicted 955
8 SASI_Hs01_00167229 predicted 1055
9 SASI_Hs01_00167230 predicted 883
10 SASI_Hs01_00167231 predicted 1027
11 SASI_Hs01_00167232 predicted 859
12 SASI_Hs01_00167233 predicted 882
13 SASI_Hs01_00167234 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002802 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00197982 predicted 811
2 SASI_Rn01_00103840 predicted 1100
3 SASI_Rn01_00103841 predicted 784
4 SASI_Rn01_00103842 predicted 496
5 SASI_Rn01_00103843 predicted 298
6 SASI_Rn01_00103845 predicted 743
7 SASI_Rn01_00103847 predicted 1030
8 SASI_Rn01_00103848 predicted 1014
9 SASI_Rn01_00103849 predicted 451
10 SASI_Rn02_00197983 predicted 1041
11 SASI_Rn01_00103844 predicted 584
12 SASI_Rn01_00103846 predicted 1065
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579078 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00151794 predicted 822
2 SASI_Rn01_00151795 predicted 1113
3 SASI_Rn01_00151796 predicted 793
4 SASI_Rn01_00151797 predicted 505
5 SASI_Rn01_00151798 predicted 591
6 SASI_Rn01_00151799 predicted 749
7 SASI_Rn01_00151800 predicted 1062
8 SASI_Rn01_00151801 predicted 1028
9 SASI_Rn01_00151802 predicted 1026
10 SASI_Rn01_00151803 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019517 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101686 predicted 823
2 SASI_Mm01_00101687 predicted 534
3 SASI_Mm01_00101689 predicted 1103
4 SASI_Mm01_00101691 predicted 768
5 SASI_Mm01_00101692 predicted 999
6 SASI_Mm01_00101693 predicted 1468
7 SASI_Mm01_00101694 predicted 850
8 SASI_Mm01_00101695 predicted 1062
9 SASI_Mm02_00324560 predicted 793
10 SASI_Mm02_00324561 predicted 293
11 SASI_Mm01_00101688 predicted 348
12 SASI_Mm01_00101690 predicted 500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019517
VALIDATED
BACE2 MISSION shRNA Bacterial Glycerol Stock
beta-site APP-cleaving enzyme 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000030499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-2680s1c1
Sequence:CCGGGCCCAAGTGTAGCAATCCAAACTCGAGTTTGGATTGCTACACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-689s1c1
Sequence:CCGGCCAAGCAAAGATTCCAGACATCTCGAGATGTCTGGAATCTTTGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-333s1c1
Sequence:CCGGCCGCAGAAGGTACAGATTCTTCTCGAGAAGAATCTGTACCTTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-795s1c1
Sequence:CCGGCCAAGTTTGTATAAAGGAGATCTCGAGATCTCCTTTATACAAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-1266s1c1
Sequence:CCGGGAAGGCTTCTACGTGGTCTTTCTCGAGAAAGACCACGTAGAAGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000445908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019517.4-1186s21c1
Sequence:CCGGTTCTCCCACAGCTCTACATTCCTCGAGGAATGTAGAGCTGTGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019517.4-1679s21c1
Sequence:CCGGGTTGGCTTCTCTGCCTATTAGCTCGAGCTAATAGGCAGAGAAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019517.4-1920s21c1
Sequence:CCGGAGGCAAGCCATGGTTAGTTACCTCGAGGTAACTAACCATGGCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019517.4-1832s21c1
Sequence:CCGGGCATTGGGCTTCAGACTTTATCTCGAGATAAAGTCTGAAGCCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019517.4-869s21c1
Sequence:CCGGAGAGGAATGGTACTATCAAATCTCGAGATTTGATAGTACCATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019517
VALIDATED
BACE2 MISSION shRNA shRNA Plasmid DNA
beta-site APP-cleaving enzyme 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000030499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-2680s1c1
Sequence:CCGGGCCCAAGTGTAGCAATCCAAACTCGAGTTTGGATTGCTACACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-689s1c1
Sequence:CCGGCCAAGCAAAGATTCCAGACATCTCGAGATGTCTGGAATCTTTGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-333s1c1
Sequence:CCGGCCGCAGAAGGTACAGATTCTTCTCGAGAAGAATCTGTACCTTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-795s1c1
Sequence:CCGGCCAAGTTTGTATAAAGGAGATCTCGAGATCTCCTTTATACAAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-1266s1c1
Sequence:CCGGGAAGGCTTCTACGTGGTCTTTCTCGAGAAAGACCACGTAGAAGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000445908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019517.4-1186s21c1
Sequence:CCGGTTCTCCCACAGCTCTACATTCCTCGAGGAATGTAGAGCTGTGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019517.4-1679s21c1
Sequence:CCGGGTTGGCTTCTCTGCCTATTAGCTCGAGCTAATAGGCAGAGAAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019517.4-1920s21c1
Sequence:CCGGAGGCAAGCCATGGTTAGTTACCTCGAGGTAACTAACCATGGCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019517.4-1832s21c1
Sequence:CCGGGCATTGGGCTTCAGACTTTATCTCGAGATAAAGTCTGAAGCCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019517.4-869s21c1
Sequence:CCGGAGAGGAATGGTACTATCAAATCTCGAGATTTGATAGTACCATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019517
VALIDATED
BACE2 MISSION shRNA Lentiviral Transduction Particles
beta-site APP-cleaving enzyme 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000030499    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-2680s1c1
Sequence:CCGGGCCCAAGTGTAGCAATCCAAACTCGAGTTTGGATTGCTACACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-689s1c1
Sequence:CCGGCCAAGCAAAGATTCCAGACATCTCGAGATGTCTGGAATCTTTGCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-333s1c1
Sequence:CCGGCCGCAGAAGGTACAGATTCTTCTCGAGAAGAATCTGTACCTTCTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-795s1c1
Sequence:CCGGCCAAGTTTGTATAAAGGAGATCTCGAGATCTCCTTTATACAAACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019517.2-1266s1c1
Sequence:CCGGGAAGGCTTCTACGTGGTCTTTCTCGAGAAAGACCACGTAGAAGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000445908    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019517.4-1186s21c1
Sequence:CCGGTTCTCCCACAGCTCTACATTCCTCGAGGAATGTAGAGCTGTGGGAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442212    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019517.4-1679s21c1
Sequence:CCGGGTTGGCTTCTCTGCCTATTAGCTCGAGCTAATAGGCAGAGAAGCCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443372    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019517.4-1920s21c1
Sequence:CCGGAGGCAAGCCATGGTTAGTTACCTCGAGGTAACTAACCATGGCTTGCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426492    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019517.4-1832s21c1
Sequence:CCGGGCATTGGGCTTCAGACTTTATCTCGAGATAAAGTCTGAAGCCCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429365    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019517.4-869s21c1
Sequence:CCGGAGAGGAATGGTACTATCAAATCTCGAGATTTGATAGTACCATTCCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012105
BACE2 MISSION shRNA Bacterial Glycerol Stock
beta-site APP-cleaving enzyme 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000051318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1623s1c1
Sequence:CCGGCCGGCCTGAATTATGAATGTTCTCGAGAACATTCATAATTCAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1514s1c1
Sequence:CCGGCCTTGGTCTTACTTCCCTAAACTCGAGTTTAGGGAAGTAAGACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-829s1c1
Sequence:CCGGGCACTCCTACATAGACACGTACTCGAGTACGTGTCTATGTAGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1438s1c1
Sequence:CCGGCGCATCTCTGATTCCAGAATTCTCGAGAATTCTGGAATCAGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1029s1c1
Sequence:CCGGCTGGGATTAAATGGAATGGAACTCGAGTTCCATTCCATTTAATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012105.3-1276s21c1
Sequence:CCGGGTGGTACTACCAGATAGAAATCTCGAGATTTCTATCTGGTAGTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012105.3-1568s21c1
Sequence:CCGGAGGTCATTCCGTATCACAATCCTCGAGGATTGTGATACGGAATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012105
BACE2 MISSION shRNA shRNA Plasmid DNA
beta-site APP-cleaving enzyme 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000051318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1623s1c1
Sequence:CCGGCCGGCCTGAATTATGAATGTTCTCGAGAACATTCATAATTCAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1514s1c1
Sequence:CCGGCCTTGGTCTTACTTCCCTAAACTCGAGTTTAGGGAAGTAAGACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-829s1c1
Sequence:CCGGGCACTCCTACATAGACACGTACTCGAGTACGTGTCTATGTAGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1438s1c1
Sequence:CCGGCGCATCTCTGATTCCAGAATTCTCGAGAATTCTGGAATCAGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1029s1c1
Sequence:CCGGCTGGGATTAAATGGAATGGAACTCGAGTTCCATTCCATTTAATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012105.3-1276s21c1
Sequence:CCGGGTGGTACTACCAGATAGAAATCTCGAGATTTCTATCTGGTAGTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012105.3-1568s21c1
Sequence:CCGGAGGTCATTCCGTATCACAATCCTCGAGGATTGTGATACGGAATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012105
BACE2 MISSION shRNA Lentiviral Transduction Particles
beta-site APP-cleaving enzyme 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000051318    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1623s1c1
Sequence:CCGGCCGGCCTGAATTATGAATGTTCTCGAGAACATTCATAATTCAGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051319    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1514s1c1
Sequence:CCGGCCTTGGTCTTACTTCCCTAAACTCGAGTTTAGGGAAGTAAGACCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-829s1c1
Sequence:CCGGGCACTCCTACATAGACACGTACTCGAGTACGTGTCTATGTAGGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1438s1c1
Sequence:CCGGCGCATCTCTGATTCCAGAATTCTCGAGAATTCTGGAATCAGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012105.3-1029s1c1
Sequence:CCGGCTGGGATTAAATGGAATGGAACTCGAGTTCCATTCCATTTAATCCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012105.3-1276s21c1
Sequence:CCGGGTGGTACTACCAGATAGAAATCTCGAGATTTCTATCTGGTAGTACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433081    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012105.3-1568s21c1
Sequence:CCGGAGGTCATTCCGTATCACAATCCTCGAGGATTGTGATACGGAATGACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks