EMAIL THIS PAGE TO A FRIEND

BACH1

BTB and CNC homology 1, basic leucine zipper transcription factor 1

75 Gene Product Result for
Synonyms: BACH-1
UniProtKB ID: O14867, O43285
Gene ID:
Human(571) Summary: This gene encodes a transcription factor that belongs to the cap'n'collar type of basic region leucine zipper factor family (CNC-bZip). The encoded protein contains broad complex, tramtrack, bric-a-brac/poxvirus and zinc finger (BTB/POZ) domains, which is atypical of CNC-bZip family members. These BTB/POZ domains facilitate protein-protein interactions and formation of homo- and/or hetero-oligomers. When this encoded protein forms a heterodimer with MafK, it functions as a repressor of Maf recognition element (MARE) and transcription is repressed. Multiple alternatively spliced transcript variants have been identified for this gene. [provided by RefSeq, May 2009]
Mouse(12013) BTB and CNC homology 1
Rat(304127) BTB and CNC homology 1, basic leucine zipper transcription factor 1
Zebrafish(553688) BTB and CNC homology 1, basic leucine zipper transcription factor 1
chicken(418488) BTB and CNC homology 1, basic leucine zipper transcription factor 1
domestic cat(101097412) BTB and CNC homology 1, basic leucine zipper transcription factor 1
cow(531350) BTB and CNC homology 1, basic leucine zipper transcription factor 1
Horse(100053654) BTB and CNC homology 1, basic leucine zipper transcription factor 1
dog(487718) BTB and CNC homology 1, basic leucine zipper transcription factor 1
sheep(101117134) BTB and CNC homology 1, basic leucine zipper transcription factor 1
Domestic Rabbit(100353797) BTB and CNC homology 1, basic leucine zipper transcription factor 1
naked mole-rat(101704988) BTB and CNC homology 1, basic leucine zipper transcription factor 1
domestic guinea pig(100712908) BTB and CNC homology 1, basic leucine zipper transcription factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001186 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001186 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001186 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007520 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007520 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007520 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011545 Rosetta Predictions human pricing
NM_001186 Rosetta Predictions human pricing
NM_206866 Rosetta Predictions human pricing
NM_001107113 Rosetta Predictions rat pricing
NM_007520 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027456 predicted 1691
2 SASI_Hs01_00027457 predicted 692
3 SASI_Hs01_00027458 predicted 1614
4 SASI_Hs01_00027460 predicted 760
5 SASI_Hs01_00027461 predicted 1116
6 SASI_Hs01_00027462 predicted 1607
7 SASI_Hs01_00027463 predicted 875
8 SASI_Hs02_00305980 predicted 1399
9 SASI_Hs01_00027464 predicted 950
10 SASI_Hs01_00027465 predicted 414
11 SASI_Hs01_00027459 predicted 1493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001186 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00208133 predicted 1662
2 SASI_Hs01_00208134 predicted 655
3 SASI_Hs01_00208135 predicted 1583
4 SASI_Hs01_00208137 predicted 730
5 SASI_Hs01_00208138 predicted 1093
6 SASI_Hs01_00208139 predicted 1576
7 SASI_Hs01_00208140 predicted 845
8 SASI_Hs02_00331323 predicted 1369
9 SASI_Hs01_00208141 predicted 914
10 SASI_Hs01_00208142 predicted 380
11 SASI_Hs01_00208136 predicted 1468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206866 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191096 predicted 1793
2 SASI_Hs01_00191097 predicted 784
3 SASI_Hs01_00191098 predicted 1719
4 SASI_Hs01_00191100 predicted 853
5 SASI_Hs01_00191101 predicted 1220
6 SASI_Hs01_00191102 predicted 1701
7 SASI_Hs01_00191103 predicted 976
8 SASI_Hs02_00373572 predicted 1504
9 SASI_Hs01_00191104 predicted 1044
10 SASI_Hs01_00191105 predicted 514
11 SASI_Hs01_00191099 predicted 1586
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107113 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00225626 predicted 1244
2 SASI_Rn02_00225627 predicted 1424
3 SASI_Rn02_00225628 predicted 1423
4 SASI_Rn02_00225629 predicted 1574
5 SASI_Rn02_00225630 predicted 402
6 SASI_Rn02_00225631 predicted 704
7 SASI_Rn02_00225632 predicted 688
8 SASI_Rn02_00225633 predicted 1627
9 SASI_Rn02_00225634 predicted 1998
10 SASI_Rn02_00225635 predicted 915
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007520 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00070072 predicted 1787
2 SASI_Mm01_00070073 predicted 1435
3 SASI_Mm01_00070074 predicted 869
4 SASI_Mm01_00070076 predicted 406
5 SASI_Mm01_00070077 predicted 389
6 SASI_Mm01_00070078 predicted 402
7 SASI_Mm01_00070079 predicted 419
8 SASI_Mm01_00070080 predicted 2355
9 SASI_Mm02_00311826 predicted 1846
10 SASI_Mm01_00070081 predicted 1664
11 SASI_Mm01_00070075 predicted 1752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001186
VALIDATED
BACH1 MISSION shRNA Bacterial Glycerol Stock
BTB and CNC homology 1, basic leucine zipper transcription factor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001186.2-2642s21c1
Sequence:CCGGGCATATCAGACAGCAATTTAACTCGAGTTAAATTGCTGTCTGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001186.2-1544s21c1
Sequence:CCGGGAAATTGGAAACGATGATTATCTCGAGATAATCATCGTTTCCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001186.2-2377s21c1
Sequence:CCGGAGCGTCTTGAAAGCCTAATATCTCGAGATATTAGGCTTTCAAGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001186.2-3172s1c1
Sequence:CCGGCCCTAGAATCTGGAGAGCTTACTCGAGTAAGCTCTCCAGATTCTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001186.2-1777s1c1
Sequence:CCGGGCTGGATTGTATCCATGATATCTCGAGATATCATGGATACAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001186.2-144s1c1
Sequence:CCGGCCTATGAATCTTCTGTGCATACTCGAGTATGCACAGAAGATTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001186.2-1590s1c1
Sequence:CCGGGCCCATATGCTTGTGTCATTACTCGAGTAATGACACAAGCATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001186.2-523s1c1
Sequence:CCGGCCAGCAAGAATGCCCAAGAAACTCGAGTTTCTTGGGCATTCTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001186
VALIDATED
BACH1 MISSION shRNA shRNA Plasmid DNA
BTB and CNC homology 1, basic leucine zipper transcription factor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001186.2-2642s21c1
Sequence:CCGGGCATATCAGACAGCAATTTAACTCGAGTTAAATTGCTGTCTGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001186.2-1544s21c1
Sequence:CCGGGAAATTGGAAACGATGATTATCTCGAGATAATCATCGTTTCCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001186.2-2377s21c1
Sequence:CCGGAGCGTCTTGAAAGCCTAATATCTCGAGATATTAGGCTTTCAAGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001186.2-3172s1c1
Sequence:CCGGCCCTAGAATCTGGAGAGCTTACTCGAGTAAGCTCTCCAGATTCTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001186.2-1777s1c1
Sequence:CCGGGCTGGATTGTATCCATGATATCTCGAGATATCATGGATACAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001186.2-144s1c1
Sequence:CCGGCCTATGAATCTTCTGTGCATACTCGAGTATGCACAGAAGATTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001186.2-1590s1c1
Sequence:CCGGGCCCATATGCTTGTGTCATTACTCGAGTAATGACACAAGCATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001186.2-523s1c1
Sequence:CCGGCCAGCAAGAATGCCCAAGAAACTCGAGTTTCTTGGGCATTCTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001186
VALIDATED
BACH1 MISSION shRNA Lentiviral Transduction Particles
BTB and CNC homology 1, basic leucine zipper transcription factor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433926    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001186.2-2642s21c1
Sequence:CCGGGCATATCAGACAGCAATTTAACTCGAGTTAAATTGCTGTCTGATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001186.2-1544s21c1
Sequence:CCGGGAAATTGGAAACGATGATTATCTCGAGATAATCATCGTTTCCAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001186.2-2377s21c1
Sequence:CCGGAGCGTCTTGAAAGCCTAATATCTCGAGATATTAGGCTTTCAAGACGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013593    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001186.2-3172s1c1
Sequence:CCGGCCCTAGAATCTGGAGAGCTTACTCGAGTAAGCTCTCCAGATTCTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013595    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001186.2-1777s1c1
Sequence:CCGGGCTGGATTGTATCCATGATATCTCGAGATATCATGGATACAATCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013594    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001186.2-144s1c1
Sequence:CCGGCCTATGAATCTTCTGTGCATACTCGAGTATGCACAGAAGATTCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_001186.2-1590s1c1
Sequence:CCGGGCCCATATGCTTGTGTCATTACTCGAGTAATGACACAAGCATATGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013596    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_001186.2-523s1c1
Sequence:CCGGCCAGCAAGAATGCCCAAGAAACTCGAGTTTCTTGGGCATTCTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007520
VALIDATED
BACH1 MISSION shRNA Bacterial Glycerol Stock
BTB and CNC homology 1, basic leucine zipper transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007520.2-1601s21c1
Sequence:CCGGGAAATTGGAAACTACGATTATCTCGAGATAATCGTAGTTTCCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007520.2-1834s21c1
Sequence:CCGGGCTCGACTGTATCCATGACATCTCGAGATGTCATGGATACAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007520.2-2593s21c1
Sequence:CCGGTATAGAATGACCAGGTAATAACTCGAGTTATTACCTGGTCATTCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007520.2-1755s21c1
Sequence:CCGGTCAATGCCCAACGGATAATTTCTCGAGAAATTATCCGTTGGGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007520.2-504s21c1
Sequence:CCGGGCGTACACAATATCGAGGAATCTCGAGATTCCTCGATATTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007520.1-399s1c1
Sequence:CCGGCCTGAAGAGGTAACGGTTAAACTCGAGTTTAACCGTTACCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007520.1-1657s1c1
Sequence:CCGGGCCCGTATGCTTGTGTGATTACTCGAGTAATCACACAAGCATACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007520.1-2840s1c1
Sequence:CCGGGCTCCTTCAAAGTCCAGCATTCTCGAGAATGCTGGACTTTGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007520.1-1844s1c1
Sequence:CCGGGCTCGACTGTATCCATGACATCTCGAGATGTCATGGATACAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007520.1-514s1c1
Sequence:CCGGGCGTACACAATATCGAGGAATCTCGAGATTCCTCGATATTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007520
VALIDATED
BACH1 MISSION shRNA shRNA Plasmid DNA
BTB and CNC homology 1, basic leucine zipper transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007520.2-1601s21c1
Sequence:CCGGGAAATTGGAAACTACGATTATCTCGAGATAATCGTAGTTTCCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007520.2-1834s21c1
Sequence:CCGGGCTCGACTGTATCCATGACATCTCGAGATGTCATGGATACAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007520.2-2593s21c1
Sequence:CCGGTATAGAATGACCAGGTAATAACTCGAGTTATTACCTGGTCATTCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007520.2-1755s21c1
Sequence:CCGGTCAATGCCCAACGGATAATTTCTCGAGAAATTATCCGTTGGGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007520.2-504s21c1
Sequence:CCGGGCGTACACAATATCGAGGAATCTCGAGATTCCTCGATATTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007520.1-399s1c1
Sequence:CCGGCCTGAAGAGGTAACGGTTAAACTCGAGTTTAACCGTTACCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007520.1-1657s1c1
Sequence:CCGGGCCCGTATGCTTGTGTGATTACTCGAGTAATCACACAAGCATACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007520.1-2840s1c1
Sequence:CCGGGCTCCTTCAAAGTCCAGCATTCTCGAGAATGCTGGACTTTGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007520.1-1844s1c1
Sequence:CCGGGCTCGACTGTATCCATGACATCTCGAGATGTCATGGATACAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007520.1-514s1c1
Sequence:CCGGGCGTACACAATATCGAGGAATCTCGAGATTCCTCGATATTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007520
VALIDATED
BACH1 MISSION shRNA Lentiviral Transduction Particles
BTB and CNC homology 1, basic leucine zipper transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007520.2-1601s21c1
Sequence:CCGGGAAATTGGAAACTACGATTATCTCGAGATAATCGTAGTTTCCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007520.2-1834s21c1
Sequence:CCGGGCTCGACTGTATCCATGACATCTCGAGATGTCATGGATACAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295568    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007520.2-2593s21c1
Sequence:CCGGTATAGAATGACCAGGTAATAACTCGAGTTATTACCTGGTCATTCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007520.2-1755s21c1
Sequence:CCGGTCAATGCCCAACGGATAATTTCTCGAGAAATTATCCGTTGGGCATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298419    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007520.2-504s21c1
Sequence:CCGGGCGTACACAATATCGAGGAATCTCGAGATTCCTCGATATTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007520.1-399s1c1
Sequence:CCGGCCTGAAGAGGTAACGGTTAAACTCGAGTTTAACCGTTACCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084282    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007520.1-1657s1c1
Sequence:CCGGGCCCGTATGCTTGTGTGATTACTCGAGTAATCACACAAGCATACGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084278    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007520.1-2840s1c1
Sequence:CCGGGCTCCTTCAAAGTCCAGCATTCTCGAGAATGCTGGACTTTGAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084280    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007520.1-1844s1c1
Sequence:CCGGGCTCGACTGTATCCATGACATCTCGAGATGTCATGGATACAGTCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007520.1-514s1c1
Sequence:CCGGGCGTACACAATATCGAGGAATCTCGAGATTCCTCGATATTGTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks