EMAIL THIS PAGE TO A FRIEND

BACH2

BTB and CNC homology 1, basic leucine zipper transcription factor 2

261 Gene Product Result for
Synonyms: BTBD25
UniProtKB ID: Q9BYV9, E1P518, Q59H70, Q5T793, Q9NTS5
Gene ID:
Mouse(12014) BTB and CNC homology 2
Rat(366340) BTB and CNC homology 1, basic leucine zipper transcription factor 2
chicken(421809) BTB and CNC homology 1, basic leucine zipper transcription factor 2
domestic cat(101098143) BTB and CNC homology 1, basic leucine zipper transcription factor 2
cow(538296) BTB and CNC homology 1, basic leucine zipper transcription factor 2
Horse(100065814) BTB and CNC homology 1, basic leucine zipper transcription factor 2
dog(481923) BTB and CNC homology 1, basic leucine zipper transcription factor 2
domestic guinea pig(100717541) BTB and CNC homology 1, basic leucine zipper transcription factor 2
naked mole-rat(101719317) BTB and CNC homology 1, basic leucine zipper transcription factor 2
sheep(101108838) BTB and CNC homology 1, basic leucine zipper transcription factor 2
Domestic Rabbit(100351257) BTB and CNC homology 1, basic leucine zipper transcription factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108650 Anti-BACH2 affinity isolated antibody rat, bovine, mouse, rabbit, guinea pig, horse, human
immunohistochemistry, western blot pricing
SAB2100201 Anti-BACH2 antibody produced in rabbit affinity isolated antibody mouse, rabbit, horse, bovine, rat, human, guinea pig
western blot pricing
SAB2104356 Anti-BACH2 antibody produced in rabbit affinity isolated antibody bovine, rat, guinea pig, rabbit, mouse, human, canine, horse
western blot pricing
HPA051384 Anti-BACH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA058384 Anti-BACH2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0574 AQUA Peptide GAAPPG[V]TR human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007521 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007521 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007521 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021813 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021813 Rosetta Predictions human pricing
NM_001109661 Rosetta Predictions mouse pricing
NM_007521 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214429 predicted 3179
2 SASI_Hs01_00214431 predicted 2741
3 SASI_Hs01_00214432 predicted 2628
4 SASI_Hs01_00214433 predicted 2438
5 SASI_Hs01_00214434 predicted 2572
6 SASI_Hs01_00214435 predicted 1828
7 SASI_Hs01_00214436 predicted 3183
8 SASI_Hs01_00214437 predicted 2448
9 SASI_Hs02_00355125 predicted 1409
10 SASI_Hs02_00355126 predicted 781
11 SASI_Hs01_00214428 predicted 2761
12 SASI_Hs01_00214430 predicted 2710
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304114 predicted 827
2 SASI_Mm02_00304115 predicted 1176
3 SASI_Mm02_00304116 predicted 455
4 SASI_Mm02_00304117 predicted 460
5 SASI_Mm02_00304118 predicted 489
6 SASI_Mm02_00304119 predicted 252
7 SASI_Mm02_00304120 predicted 2627
8 SASI_Mm02_00304121 predicted 921
9 SASI_Mm02_00304122 predicted 360
10 SASI_Mm02_00304123 predicted 2732
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007521 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038082 predicted 908
2 SASI_Mm01_00038083 predicted 1067
3 SASI_Mm01_00038084 predicted 500
4 SASI_Mm01_00038086 predicted 2502
5 SASI_Mm01_00038087 predicted 2503
6 SASI_Mm02_00311827 predicted 1168
7 SASI_Mm01_00038088 predicted 611
8 SASI_Mm01_00038089 predicted 2611
9 SASI_Mm01_00038090 predicted 2610
10 SASI_Mm01_00038091 predicted 2506
11 SASI_Mm01_00038085 predicted 2508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007521
BACH2 MISSION shRNA Bacterial Glycerol Stock
BTB and CNC homology 1, basic leucine zipper transcription factor 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007521.2-2964s1c1
Sequence:CCGGGCTTCTATACACATCAAAGTTCTCGAGAACTTTGATGTGTATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-2384s1c1
Sequence:CCGGGCAACACCTCTGAGAATTGTACTCGAGTACAATTCTCAGAGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-493s1c1
Sequence:CCGGGACCAACGGAAGAAGGACATTCTCGAGAATGTCCTTCTTCCGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-1083s1c1
Sequence:CCGGCCAGTACCCTAGATATAAGAACTCGAGTTCTTATATCTAGGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-1780s1c1
Sequence:CCGGGAGCAGTCTTACGGAACCAATCTCGAGATTGGTTCCGTAAGACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007521.3-1427s21c1
Sequence:CCGGTGCGGTCTCTGTTCGGTATAACTCGAGTTATACCGAACAGAGACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007521.3-2665s21c1
Sequence:CCGGTGAAGAACCAAGAGCGAATTTCTCGAGAAATTCGCTCTTGGTTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007521
BACH2 MISSION shRNA shRNA Plasmid DNA
BTB and CNC homology 1, basic leucine zipper transcription factor 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007521.2-2964s1c1
Sequence:CCGGGCTTCTATACACATCAAAGTTCTCGAGAACTTTGATGTGTATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-2384s1c1
Sequence:CCGGGCAACACCTCTGAGAATTGTACTCGAGTACAATTCTCAGAGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-493s1c1
Sequence:CCGGGACCAACGGAAGAAGGACATTCTCGAGAATGTCCTTCTTCCGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-1083s1c1
Sequence:CCGGCCAGTACCCTAGATATAAGAACTCGAGTTCTTATATCTAGGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-1780s1c1
Sequence:CCGGGAGCAGTCTTACGGAACCAATCTCGAGATTGGTTCCGTAAGACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007521.3-1427s21c1
Sequence:CCGGTGCGGTCTCTGTTCGGTATAACTCGAGTTATACCGAACAGAGACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007521.3-2665s21c1
Sequence:CCGGTGAAGAACCAAGAGCGAATTTCTCGAGAAATTCGCTCTTGGTTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007521
BACH2 MISSION shRNA Lentiviral Transduction Particles
BTB and CNC homology 1, basic leucine zipper transcription factor 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084328    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007521.2-2964s1c1
Sequence:CCGGGCTTCTATACACATCAAAGTTCTCGAGAACTTTGATGTGTATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084331    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-2384s1c1
Sequence:CCGGGCAACACCTCTGAGAATTGTACTCGAGTACAATTCTCAGAGGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-493s1c1
Sequence:CCGGGACCAACGGAAGAAGGACATTCTCGAGAATGTCCTTCTTCCGTTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084330    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-1083s1c1
Sequence:CCGGCCAGTACCCTAGATATAAGAACTCGAGTTCTTATATCTAGGGTACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084329    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007521.2-1780s1c1
Sequence:CCGGGAGCAGTCTTACGGAACCAATCTCGAGATTGGTTCCGTAAGACTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007521.3-1427s21c1
Sequence:CCGGTGCGGTCTCTGTTCGGTATAACTCGAGTTATACCGAACAGAGACCGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436191    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007521.3-2665s21c1
Sequence:CCGGTGAAGAACCAAGAGCGAATTTCTCGAGAAATTCGCTCTTGGTTCTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021813
VALIDATED
BACH2 MISSION shRNA Bacterial Glycerol Stock
BTB and CNC homology 1, basic leucine zipper transcription factor 2
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021813.1-1479s1c1
Sequence:CCGGCCGGGAAGATAACTCTAGCAACTCGAGTTGCTAGAGTTATCTTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021813.1-2743s1c1
Sequence:CCGGCGCAAATTGGTGTGTGAGAAACTCGAGTTTCTCACACACCAATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021813.1-3213s1c1
Sequence:CCGGGCCCAGGAAAGATTATACCTACTCGAGTAGGTATAATCTTTCCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_021813.1-2560s1c1
Sequence:CCGGCCTGTAGATCAAATCACAGATCTCGAGATCTGTGATTTGATCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021813.1-1410s1c1
Sequence:CCGGCCAGCTTGCATGTACCAAGAACTCGAGTTCTTGGTACATGCAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2544s21c1
Sequence:CCGGATTAAATGTGAGCAGTCTTATCTCGAGATAAGACTGCTCACATTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-1726s21c1
Sequence:CCGGATGTCGAGATGGACCGGAAACCTCGAGGTTTCCGGTCCATCTCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021813.2-3499s21c1
Sequence:CCGGTCGAGCAGGAGTGATAGTTACCTCGAGGTAACTATCACTCCTGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-910s21c1
Sequence:CCGGATATTCTCTGTGACGTGACTTCTCGAGAAGTCACGTCACAGAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2005s21c1
Sequence:CCGGAGAAGGAGGTGTCCAACTTCACTCGAGTGAAGTTGGACACCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021813.2-3444s21c1
Sequence:CCGGTGCACACTACAGCGGTCTTAGCTCGAGCTAAGACCGCTGTAGTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-857s21c1
Sequence:CCGGCACAGTCCACTGCACCAACATCTCGAGATGTTGGTGCAGTGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2133s21c1
Sequence:CCGGAGCACCTCGGTGCATTCTTATCTCGAGATAAGAATGCACCGAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2730s21c1
Sequence:CCGGTCAGAACAGTTAGAGTTTATTCTCGAGAATAAACTCTAACTGTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021813.2-3408s21c1
Sequence:CCGGCATCTGCTGTCCCGAAGAAACCTCGAGGTTTCTTCGGGACAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-973s21c1
Sequence:CCGGTGGCCGCATGCAGTGAATATTCTCGAGAATATTCACTGCATGCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2579s21c1
Sequence:CCGGTGACGAATCCGGATCGTTCTCCTCGAGGAGAACGATCCGGATTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021813
VALIDATED
BACH2 MISSION shRNA shRNA Plasmid DNA
BTB and CNC homology 1, basic leucine zipper transcription factor 2
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021813.1-1479s1c1
Sequence:CCGGCCGGGAAGATAACTCTAGCAACTCGAGTTGCTAGAGTTATCTTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021813.1-2743s1c1
Sequence:CCGGCGCAAATTGGTGTGTGAGAAACTCGAGTTTCTCACACACCAATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021813.1-3213s1c1
Sequence:CCGGGCCCAGGAAAGATTATACCTACTCGAGTAGGTATAATCTTTCCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_021813.1-2560s1c1
Sequence:CCGGCCTGTAGATCAAATCACAGATCTCGAGATCTGTGATTTGATCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021813.1-1410s1c1
Sequence:CCGGCCAGCTTGCATGTACCAAGAACTCGAGTTCTTGGTACATGCAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2544s21c1
Sequence:CCGGATTAAATGTGAGCAGTCTTATCTCGAGATAAGACTGCTCACATTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-1726s21c1
Sequence:CCGGATGTCGAGATGGACCGGAAACCTCGAGGTTTCCGGTCCATCTCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021813.2-3499s21c1
Sequence:CCGGTCGAGCAGGAGTGATAGTTACCTCGAGGTAACTATCACTCCTGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-910s21c1
Sequence:CCGGATATTCTCTGTGACGTGACTTCTCGAGAAGTCACGTCACAGAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2005s21c1
Sequence:CCGGAGAAGGAGGTGTCCAACTTCACTCGAGTGAAGTTGGACACCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021813.2-3444s21c1
Sequence:CCGGTGCACACTACAGCGGTCTTAGCTCGAGCTAAGACCGCTGTAGTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-857s21c1
Sequence:CCGGCACAGTCCACTGCACCAACATCTCGAGATGTTGGTGCAGTGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2133s21c1
Sequence:CCGGAGCACCTCGGTGCATTCTTATCTCGAGATAAGAATGCACCGAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2730s21c1
Sequence:CCGGTCAGAACAGTTAGAGTTTATTCTCGAGAATAAACTCTAACTGTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021813.2-3408s21c1
Sequence:CCGGCATCTGCTGTCCCGAAGAAACCTCGAGGTTTCTTCGGGACAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-973s21c1
Sequence:CCGGTGGCCGCATGCAGTGAATATTCTCGAGAATATTCACTGCATGCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2579s21c1
Sequence:CCGGTGACGAATCCGGATCGTTCTCCTCGAGGAGAACGATCCGGATTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021813
VALIDATED
BACH2 MISSION shRNA Lentiviral Transduction Particles
BTB and CNC homology 1, basic leucine zipper transcription factor 2
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021813.1-1479s1c1
Sequence:CCGGCCGGGAAGATAACTCTAGCAACTCGAGTTGCTAGAGTTATCTTCCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018114    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_021813.1-2743s1c1
Sequence:CCGGCGCAAATTGGTGTGTGAGAAACTCGAGTTTCTCACACACCAATTTGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021813.1-3213s1c1
Sequence:CCGGGCCCAGGAAAGATTATACCTACTCGAGTAGGTATAATCTTTCCTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018116    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_021813.1-2560s1c1
Sequence:CCGGCCTGTAGATCAAATCACAGATCTCGAGATCTGTGATTTGATCTACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021813.1-1410s1c1
Sequence:CCGGCCAGCTTGCATGTACCAAGAACTCGAGTTCTTGGTACATGCAAGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2544s21c1
Sequence:CCGGATTAAATGTGAGCAGTCTTATCTCGAGATAAGACTGCTCACATTTAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-1726s21c1
Sequence:CCGGATGTCGAGATGGACCGGAAACCTCGAGGTTTCCGGTCCATCTCGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413240    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021813.2-3499s21c1
Sequence:CCGGTCGAGCAGGAGTGATAGTTACCTCGAGGTAACTATCACTCCTGCTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-910s21c1
Sequence:CCGGATATTCTCTGTGACGTGACTTCTCGAGAAGTCACGTCACAGAGAATATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417909    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2005s21c1
Sequence:CCGGAGAAGGAGGTGTCCAACTTCACTCGAGTGAAGTTGGACACCTCCTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418256    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021813.2-3444s21c1
Sequence:CCGGTGCACACTACAGCGGTCTTAGCTCGAGCTAAGACCGCTGTAGTGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-857s21c1
Sequence:CCGGCACAGTCCACTGCACCAACATCTCGAGATGTTGGTGCAGTGGACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2133s21c1
Sequence:CCGGAGCACCTCGGTGCATTCTTATCTCGAGATAAGAATGCACCGAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428556    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2730s21c1
Sequence:CCGGTCAGAACAGTTAGAGTTTATTCTCGAGAATAAACTCTAACTGTTCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429903    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021813.2-3408s21c1
Sequence:CCGGCATCTGCTGTCCCGAAGAAACCTCGAGGTTTCTTCGGGACAGCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423629    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-973s21c1
Sequence:CCGGTGGCCGCATGCAGTGAATATTCTCGAGAATATTCACTGCATGCGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021813.2-2579s21c1
Sequence:CCGGTGACGAATCCGGATCGTTCTCCTCGAGGAGAACGATCCGGATTCGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks