EMAIL THIS PAGE TO A FRIEND

BAD

BCL2-associated agonist of cell death

Synonyms: BBC2 BCL2L8
UniProtKB ID: Q92934, O14803, Q6FH21
Gene ID:
Human(572) Summary: The protein encoded by this gene is a member of the BCL-2 family. BCL-2 family members are known to be regulators of programmed cell death. This protein positively regulates cell apoptosis by forming heterodimers with BCL-xL and BCL-2, and reversing their death repressor activity. Proapoptotic activity of this protein is regulated through its phosphorylation. Protein kinases AKT and MAP kinase, as well as protein phosphatase calcineurin were found to be involved in the regulation of this protein. Alternative splicing of this gene results in two transcript variants which encode the same isoform. [provided by RefSeq, Jul 2008]
Mouse(12015) BCL2-associated agonist of cell death
Rat(64639) BCL2-associated agonist of cell death
domestic cat(768269) BCL2-associated agonist of cell death
dog(483763) BCL2-associated agonist of cell death
cow(615013) BCL2-associated agonist of cell death
sheep(780444) BCL2-associated agonist of cell death
naked mole-rat(101726042) BCL2-associated agonist of cell death
domestic guinea pig(100734151) BCL2-associated agonist of cell death
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4300341 Anti-BAD (Ab-112) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300342 Anti-BAD (Ab-136) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300343 Anti-BAD (Ab-155) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4500297 Anti-BAD (Cleaved-Asp71) antibody produced in rabbit affinity isolated antibody rat, mouse
immunohistochemistry, western blot pricing
GW22764 Anti-BAD antibody produced in chicken affinity isolated antibody, buffered aqueous solution rat, human
western blot pricing
B0684 Anti-Bad antibody produced in rabbit affinity isolated antibody, lyophilized powder mouse, human
western blot pricing
HPA062105 Anti-BAD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA028185 Anti-BAD antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB3500336 Anti-BAD antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4502464 Anti-BAD antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB4502465 Anti-BAD antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4502467 Anti-BAD antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4502468 Anti-BAD antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB1306697 ANTI-BAD BH3 DOMAIN antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
SAB4502466 Anti-BAD, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
SAB4300050 Anti-phospho-BAD (pSer112) antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
SAB4504345 Anti-phospho-BAD (pSer112) antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504114 Anti-phospho-BAD (pSer134) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300051 Anti-phospho-BAD (pSer136) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4504346 Anti-phospho-BAD (pSer136) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504344 Anti-phospho-BAD (pSer155) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504113 Anti-phospho-BAD (pSer91/128) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4301255 Anti-phospho-BAD (pSer91/128) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
WH0000572M2 Monoclonal Anti-BAD antibody produced in mouse clone 3H8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
B0559 Monoclonal Anti-Bad antibody produced in rat clone 64103, purified immunoglobulin, lyophilized powder mouse
microarray, western blot pricing
SAB1305489 MONOCLONAL ANTI-PHOSPHO-MBAD(SER155) antibody produced in mouse clone 27AT381, IgG fraction of antiserum, buffered aqueous solution mouse, human
western blot pricing
SAB1305485 MONOCLONAL ANTI-PHOSPHO-MBAD(SER155) antibody produced in mouse clone 27AT937, IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0757 Mouse Bad / Bcl2 antagonist of Cell Death ELISA Kit mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007522 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007522 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007522 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004322 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU077271 MISSION® esiRNA esiRNA human BAD (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004322 siRNAs that have been validated in the lab human pricing
NM_032989 siRNAs that have been validated in the lab human pricing
NM_022698 Rosetta Predictions rat pricing
NM_007522 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004322 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197021 validated 598
2 SASI_Hs01_00197022 predicted 844
3 SASI_Hs01_00197023 predicted 874
4 SASI_Hs01_00197024 predicted 740
5 SASI_Hs01_00197025 predicted 655
6 SASI_Hs01_00197026 predicted 816
7 SASI_Hs01_00197027 predicted 749
8 SASI_Hs01_00197028 predicted 594
9 SASI_Hs01_00197029 predicted 643
10 SASI_Hs01_00197030 predicted 592
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032989 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00065170 validated 425
2 SASI_Hs01_00065171 predicted 667
3 SASI_Hs01_00065172 predicted 707
4 SASI_Hs01_00065173 predicted 569
5 SASI_Hs01_00065174 predicted 479
6 SASI_Hs01_00065175 predicted 638
7 SASI_Hs01_00065176 predicted 570
8 SASI_Hs01_00065177 predicted 418
9 SASI_Hs01_00065178 predicted 479
10 SASI_Hs01_00065179 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022698 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064683 predicted 542
2 SASI_Rn01_00064684 predicted 560
3 SASI_Rn01_00064685 predicted 513
4 SASI_Rn01_00064686 predicted 606
5 SASI_Rn01_00064687 predicted 677
6 SASI_Rn01_00064688 predicted 543
7 SASI_Rn01_00064689 predicted 452
8 SASI_Rn01_00064690 predicted 741
9 SASI_Rn01_00064691 predicted 433
10 SASI_Rn01_00064692 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007522 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00031783 predicted 625
2 SASI_Mm01_00031784 predicted 633
3 SASI_Mm01_00031785 predicted 923
4 SASI_Mm01_00031786 predicted 621
5 SASI_Mm01_00031787 predicted 619
6 SASI_Mm01_00031788 predicted 936
7 SASI_Mm01_00031789 predicted 740
8 SASI_Mm01_00031791 predicted 585
9 SASI_Mm01_00031792 predicted 912
10 SASI_Mm02_00311828 predicted 603
11 SASI_Mm01_00031790 predicted 787
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007522
VALIDATED
BAD MISSION shRNA Bacterial Glycerol Stock
BCL2-associated agonist of cell death
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007522.2-633s21c1
Sequence:CCGGAGACGCTAGTGCTACAGATAGCTCGAGCTATCTGTAGCACTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007522.2-985s21c1
Sequence:CCGGACTGCAACACAGATGCGACAACTCGAGTTGTCGCATCTGTGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007522.2-1039s21c1
Sequence:CCGGTGGGATCGAAACTTGGGCAAACTCGAGTTTGCCCAAGTTTCGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007522.2-1262s21c1
Sequence:CCGGGCTCCTGTTTGGAGTTTCAAACTCGAGTTTGAAACTCCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007522.2-922s21c1
Sequence:CCGGCGAAGGATGAGCGATGAGTTTCTCGAGAAACTCATCGCTCATCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007522.1-1264s1c1
Sequence:CCGGGCTCCTGTTTGGAGTTTCAAACTCGAGTTTGAAACTCCAAACAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007522.1-924s1c1
Sequence:CCGGCGAAGGATGAGCGATGAGTTTCTCGAGAAACTCATCGCTCATCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007522.1-1041s1c1
Sequence:CCGGTGGGATCGAAACTTGGGCAAACTCGAGTTTGCCCAAGTTTCGATCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007522.1-633s1c1
Sequence:CCGGGAAGACGCTAGTGCTACAGATCTCGAGATCTGTAGCACTAGCGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007522.1-987s1c1
Sequence:CCGGACTGCAACACAGATGCGACAACTCGAGTTGTCGCATCTGTGTTGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007522
VALIDATED
BAD MISSION shRNA shRNA Plasmid DNA
BCL2-associated agonist of cell death
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007522.2-633s21c1
Sequence:CCGGAGACGCTAGTGCTACAGATAGCTCGAGCTATCTGTAGCACTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007522.2-985s21c1
Sequence:CCGGACTGCAACACAGATGCGACAACTCGAGTTGTCGCATCTGTGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007522.2-1039s21c1
Sequence:CCGGTGGGATCGAAACTTGGGCAAACTCGAGTTTGCCCAAGTTTCGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007522.2-1262s21c1
Sequence:CCGGGCTCCTGTTTGGAGTTTCAAACTCGAGTTTGAAACTCCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007522.2-922s21c1
Sequence:CCGGCGAAGGATGAGCGATGAGTTTCTCGAGAAACTCATCGCTCATCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007522.1-1264s1c1
Sequence:CCGGGCTCCTGTTTGGAGTTTCAAACTCGAGTTTGAAACTCCAAACAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007522.1-924s1c1
Sequence:CCGGCGAAGGATGAGCGATGAGTTTCTCGAGAAACTCATCGCTCATCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007522.1-1041s1c1
Sequence:CCGGTGGGATCGAAACTTGGGCAAACTCGAGTTTGCCCAAGTTTCGATCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007522.1-633s1c1
Sequence:CCGGGAAGACGCTAGTGCTACAGATCTCGAGATCTGTAGCACTAGCGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007522.1-987s1c1
Sequence:CCGGACTGCAACACAGATGCGACAACTCGAGTTGTCGCATCTGTGTTGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007522
VALIDATED
BAD MISSION shRNA Lentiviral Transduction Particles
BCL2-associated agonist of cell death
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007522.2-633s21c1
Sequence:CCGGAGACGCTAGTGCTACAGATAGCTCGAGCTATCTGTAGCACTAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321138    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007522.2-985s21c1
Sequence:CCGGACTGCAACACAGATGCGACAACTCGAGTTGTCGCATCTGTGTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007522.2-1039s21c1
Sequence:CCGGTGGGATCGAAACTTGGGCAAACTCGAGTTTGCCCAAGTTTCGATCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321140    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007522.2-1262s21c1
Sequence:CCGGGCTCCTGTTTGGAGTTTCAAACTCGAGTTTGAAACTCCAAACAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321137    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007522.2-922s21c1
Sequence:CCGGCGAAGGATGAGCGATGAGTTTCTCGAGAAACTCATCGCTCATCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009696    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007522.1-1264s1c1
Sequence:CCGGGCTCCTGTTTGGAGTTTCAAACTCGAGTTTGAAACTCCAAACAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009697    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007522.1-924s1c1
Sequence:CCGGCGAAGGATGAGCGATGAGTTTCTCGAGAAACTCATCGCTCATCCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007522.1-1041s1c1
Sequence:CCGGTGGGATCGAAACTTGGGCAAACTCGAGTTTGCCCAAGTTTCGATCCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009699    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007522.1-633s1c1
Sequence:CCGGGAAGACGCTAGTGCTACAGATCTCGAGATCTGTAGCACTAGCGTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007522.1-987s1c1
Sequence:CCGGACTGCAACACAGATGCGACAACTCGAGTTGTCGCATCTGTGTTGCAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004322
VALIDATED
BAD MISSION shRNA Bacterial Glycerol Stock
BCL2-associated agonist of cell death
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004322.2-596s1c1
Sequence:CCGGGACGAGTTTGTGGACTCCTTTCTCGAGAAAGGAGTCCACAAACTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-448s1c1
Sequence:CCGGCCGGAGTCGCCACAGCTCCTACTCGAGTAGGAGCTGTGGCGACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-608s1c1
Sequence:CCGGGACTCCTTTAAGAAGGGACTTCTCGAGAAGTCCCTTCTTAAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-332s1c1
Sequence:CCGGCCCTCAGGCTCCGGCAAGCATCTCGAGATGCTTGCCGGAGCCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-694s1c1
Sequence:CCGGCCAGTCCTGGTGGGATCGGAACTCGAGTTCCGATCCCACCAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004322
VALIDATED
BAD MISSION shRNA shRNA Plasmid DNA
BCL2-associated agonist of cell death
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004322.2-596s1c1
Sequence:CCGGGACGAGTTTGTGGACTCCTTTCTCGAGAAAGGAGTCCACAAACTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-448s1c1
Sequence:CCGGCCGGAGTCGCCACAGCTCCTACTCGAGTAGGAGCTGTGGCGACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-608s1c1
Sequence:CCGGGACTCCTTTAAGAAGGGACTTCTCGAGAAGTCCCTTCTTAAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-332s1c1
Sequence:CCGGCCCTCAGGCTCCGGCAAGCATCTCGAGATGCTTGCCGGAGCCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-694s1c1
Sequence:CCGGCCAGTCCTGGTGGGATCGGAACTCGAGTTCCGATCCCACCAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004322
VALIDATED
BAD MISSION shRNA Lentiviral Transduction Particles
BCL2-associated agonist of cell death
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_004322.2-596s1c1
Sequence:CCGGGACGAGTTTGTGGACTCCTTTCTCGAGAAAGGAGTCCACAAACTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-448s1c1
Sequence:CCGGCCGGAGTCGCCACAGCTCCTACTCGAGTAGGAGCTGTGGCGACTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-608s1c1
Sequence:CCGGGACTCCTTTAAGAAGGGACTTCTCGAGAAGTCCCTTCTTAAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-332s1c1
Sequence:CCGGCCCTCAGGCTCCGGCAAGCATCTCGAGATGCTTGCCGGAGCCTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004322.2-694s1c1
Sequence:CCGGCCAGTCCTGGTGGGATCGGAACTCGAGTTCCGATCCCACCAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks