EMAIL THIS PAGE TO A FRIEND

BAG1

BCL2-associated athanogene

138 Gene Product Result for
Synonyms: BAG-1 HAP RAP46
Gene ID:
Human(573) Summary: The oncogene BCL2 is a membrane protein that blocks a step in a pathway leading to apoptosis or programmed cell death. The protein encoded by this gene binds to BCL2 and is referred to as BCL2-associated athanogene. It enhances the anti-apoptotic effects of BCL2 and represents a link between growth factor receptors and anti-apoptotic mechanisms. Multiple protein isoforms are encoded by this mRNA through the use of a non-AUG (CUG) initiation codon, and three alternative downstream AUG initiation codons. A related pseudogene has been defined on chromosome X. [provided by RefSeq, Feb 2010]
Mouse(12017) BCL2-associated athanogene 1
Rat(297994) BCL2-associated athanogene
Zebrafish(558108) BCL2-associated athanogene 1
Thale Cress(835281) BCL-2-associated athanogene 1
cow(781741) BCL2-associated athanogene
cow(613855) BCL2-associated athanogene
domestic cat(101101174) BCL2-associated athanogene
dog(611781) BCL2-associated athanogene
chicken(420967) BCL2-associated athanogene
naked mole-rat(101710733) BCL2-associated athanogene
domestic guinea pig(100719878) BCL2-associated athanogene
sheep(101117995) BCL2-associated athanogene
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009736 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009736 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009736 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU055401 MISSION® esiRNA esiRNA human BAG1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004323 siRNAs that have been validated in the lab human pricing
NM_001106647 Rosetta Predictions rat pricing
NM_009736 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004323 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068679 validated 540
2 SASI_Hs01_00068680 predicted 896
3 SASI_Hs01_00068681 predicted 577
4 SASI_Hs01_00068682 predicted 926
5 SASI_Hs01_00068683 predicted 1192
6 SASI_Hs01_00068685 predicted 1602
7 SASI_Hs01_00068687 predicted 1616
8 SASI_Hs01_00068688 predicted 925
9 SASI_Hs02_00337361 predicted 1600
10 SASI_Hs02_00337362 predicted 1590
11 SASI_Hs01_00068684 predicted 1282
12 SASI_Hs01_00068686 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106647 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221008 predicted 622
2 SASI_Rn02_00221009 predicted 540
3 SASI_Rn02_00221010 predicted 823
4 SASI_Rn02_00221011 predicted 922
5 SASI_Rn02_00221012 predicted 303
6 SASI_Rn02_00221013 predicted 242
7 SASI_Rn02_00221014 predicted 693
8 SASI_Rn02_00221015 predicted 924
9 SASI_Rn02_00221016 predicted 565
10 SASI_Rn02_00221017 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126263 predicted 641
2 SASI_Mm01_00126264 predicted 560
3 SASI_Mm01_00126265 predicted 942
4 SASI_Mm01_00126266 predicted 1080
5 SASI_Mm01_00126267 predicted 273
6 SASI_Mm01_00126268 predicted 1049
7 SASI_Mm01_00126269 predicted 598
8 SASI_Mm01_00126271 predicted 945
9 SASI_Mm01_00126272 predicted 840
10 SASI_Mm02_00316902 predicted 1070
11 SASI_Mm01_00126270 predicted 674
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004323
VALIDATED
BAG1 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-1156s1c1
Sequence:CCGGCCGTCTCTGGATCGGAATTTACTCGAGTAAATTCCGATCCAGAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-880s1c1
Sequence:CCGGGCAAACTTGATAGGAGAGTAACTCGAGTTACTCTCCTATCAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-666s1c1
Sequence:CCGGGAAACACCGTTGTCAGCACTTCTCGAGAAGTGCTGACAACGGTGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-506s1c1
Sequence:CCGGTGTCACCCACAGCAATGAGAACTCGAGTTCTCATTGCTGTGGGTGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004323.2-1073s1c1
Sequence:CCGGGCAGTCTACAAACTTTGCCCTCTCGAGAGGGCAAAGTTTGTAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-721s21c1
Sequence:CCGGATGGTTGCCGGGTCATGTTAACTCGAGTTAACATGACCCGGCAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-1120s21c1
Sequence:CCGGCCGAGTGAGGTGTAGCAGAAACTCGAGTTTCTGCTACACCTCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-361s21c1
Sequence:CCGGAGTTGACCCTGAGTGAGGAAGCTCGAGCTTCCTCACTCAGGGTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004323.4-1189s21c1
Sequence:CCGGGAGCGGAATTTACCTGATTTCCTCGAGGAAATCAGGTAAATTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-758s21c1
Sequence:CCGGTCCACAGGAAGAGGTTGAACTCTCGAGAGTTCAACCTCTTCCTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-927s21c1
Sequence:CCGGGCCACAATAGAGCAGTTTATGCTCGAGCATAAACTGCTCTATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004323.4-1449s21c1
Sequence:CCGGTTGGGCCAGTTTCAGGTTTATCTCGAGATAAACCTGAAACTGGCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004323
VALIDATED
BAG1 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-1156s1c1
Sequence:CCGGCCGTCTCTGGATCGGAATTTACTCGAGTAAATTCCGATCCAGAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-880s1c1
Sequence:CCGGGCAAACTTGATAGGAGAGTAACTCGAGTTACTCTCCTATCAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-666s1c1
Sequence:CCGGGAAACACCGTTGTCAGCACTTCTCGAGAAGTGCTGACAACGGTGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-506s1c1
Sequence:CCGGTGTCACCCACAGCAATGAGAACTCGAGTTCTCATTGCTGTGGGTGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004323.2-1073s1c1
Sequence:CCGGGCAGTCTACAAACTTTGCCCTCTCGAGAGGGCAAAGTTTGTAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-721s21c1
Sequence:CCGGATGGTTGCCGGGTCATGTTAACTCGAGTTAACATGACCCGGCAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-1120s21c1
Sequence:CCGGCCGAGTGAGGTGTAGCAGAAACTCGAGTTTCTGCTACACCTCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-361s21c1
Sequence:CCGGAGTTGACCCTGAGTGAGGAAGCTCGAGCTTCCTCACTCAGGGTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004323.4-1189s21c1
Sequence:CCGGGAGCGGAATTTACCTGATTTCCTCGAGGAAATCAGGTAAATTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-758s21c1
Sequence:CCGGTCCACAGGAAGAGGTTGAACTCTCGAGAGTTCAACCTCTTCCTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-927s21c1
Sequence:CCGGGCCACAATAGAGCAGTTTATGCTCGAGCATAAACTGCTCTATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004323.4-1449s21c1
Sequence:CCGGTTGGGCCAGTTTCAGGTTTATCTCGAGATAAACCTGAAACTGGCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004323
VALIDATED
BAG1 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007295    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-1156s1c1
Sequence:CCGGCCGTCTCTGGATCGGAATTTACTCGAGTAAATTCCGATCCAGAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-880s1c1
Sequence:CCGGGCAAACTTGATAGGAGAGTAACTCGAGTTACTCTCCTATCAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007297    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-666s1c1
Sequence:CCGGGAAACACCGTTGTCAGCACTTCTCGAGAAGTGCTGACAACGGTGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_004323.2-506s1c1
Sequence:CCGGTGTCACCCACAGCAATGAGAACTCGAGTTCTCATTGCTGTGGGTGACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004323.2-1073s1c1
Sequence:CCGGGCAGTCTACAAACTTTGCCCTCTCGAGAGGGCAAAGTTTGTAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-721s21c1
Sequence:CCGGATGGTTGCCGGGTCATGTTAACTCGAGTTAACATGACCCGGCAACCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-1120s21c1
Sequence:CCGGCCGAGTGAGGTGTAGCAGAAACTCGAGTTTCTGCTACACCTCACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-361s21c1
Sequence:CCGGAGTTGACCCTGAGTGAGGAAGCTCGAGCTTCCTCACTCAGGGTCAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417994    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004323.4-1189s21c1
Sequence:CCGGGAGCGGAATTTACCTGATTTCCTCGAGGAAATCAGGTAAATTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-758s21c1
Sequence:CCGGTCCACAGGAAGAGGTTGAACTCTCGAGAGTTCAACCTCTTCCTGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004323.4-927s21c1
Sequence:CCGGGCCACAATAGAGCAGTTTATGCTCGAGCATAAACTGCTCTATTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429987    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004323.4-1449s21c1
Sequence:CCGGTTGGGCCAGTTTCAGGTTTATCTCGAGATAAACCTGAAACTGGCCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009736
VALIDATED
BAG1 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009736.1-1105s1c1
Sequence:CCGGGCAGTGGAGAGTGGCTGTACTCTCGAGAGTACAGCCACTCTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009736.1-317s1c1
Sequence:CCGGGAAGTAAGAAAGTGACCCGTACTCGAGTACGGGTCACTTTCTTACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009736.1-798s1c1
Sequence:CCGGCCACCTGCAAGAATTGAATAACTCGAGTTATTCAATTCTTGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009736.1-703s1c1
Sequence:CCGGCGAGTCATGTTAATTGGTGAACTCGAGTTCACCAATTAACATGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009736.1-878s1c1
Sequence:CCGGGCAAACTTGATAGGAAAGTAACTCGAGTTACTTTCCTATCAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-781s21c1
Sequence:CCGGAGAAGAAGAGGTTGAGTTAAACTCGAGTTTAACTCAACCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-1174s21c1
Sequence:CCGGCCTGAAGAGCAGCTTTACAGCCTCGAGGCTGTAAAGCTGCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-1073s21c1
Sequence:CCGGTGTGACACAGTGGAGCAATACCTCGAGGTATTGCTCCACTGTGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-844s21c1
Sequence:CCGGCCACCTGCAAGAATTGAATAACTCGAGTTATTCAATTCTTGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009736.2-995s21c1
Sequence:CCGGGTCCTACCAGAACAATTTAAACTCGAGTTTAAATTGTTCTGGTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009736
VALIDATED
BAG1 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009736.1-1105s1c1
Sequence:CCGGGCAGTGGAGAGTGGCTGTACTCTCGAGAGTACAGCCACTCTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009736.1-317s1c1
Sequence:CCGGGAAGTAAGAAAGTGACCCGTACTCGAGTACGGGTCACTTTCTTACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009736.1-798s1c1
Sequence:CCGGCCACCTGCAAGAATTGAATAACTCGAGTTATTCAATTCTTGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009736.1-703s1c1
Sequence:CCGGCGAGTCATGTTAATTGGTGAACTCGAGTTCACCAATTAACATGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009736.1-878s1c1
Sequence:CCGGGCAAACTTGATAGGAAAGTAACTCGAGTTACTTTCCTATCAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-781s21c1
Sequence:CCGGAGAAGAAGAGGTTGAGTTAAACTCGAGTTTAACTCAACCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-1174s21c1
Sequence:CCGGCCTGAAGAGCAGCTTTACAGCCTCGAGGCTGTAAAGCTGCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-1073s21c1
Sequence:CCGGTGTGACACAGTGGAGCAATACCTCGAGGTATTGCTCCACTGTGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-844s21c1
Sequence:CCGGCCACCTGCAAGAATTGAATAACTCGAGTTATTCAATTCTTGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009736.2-995s21c1
Sequence:CCGGGTCCTACCAGAACAATTTAAACTCGAGTTTAAATTGTTCTGGTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009736
VALIDATED
BAG1 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012368    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009736.1-1105s1c1
Sequence:CCGGGCAGTGGAGAGTGGCTGTACTCTCGAGAGTACAGCCACTCTCCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009736.1-317s1c1
Sequence:CCGGGAAGTAAGAAAGTGACCCGTACTCGAGTACGGGTCACTTTCTTACTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009736.1-798s1c1
Sequence:CCGGCCACCTGCAAGAATTGAATAACTCGAGTTATTCAATTCTTGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012370    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009736.1-703s1c1
Sequence:CCGGCGAGTCATGTTAATTGGTGAACTCGAGTTCACCAATTAACATGACTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012369    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009736.1-878s1c1
Sequence:CCGGGCAAACTTGATAGGAAAGTAACTCGAGTTACTTTCCTATCAAGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-781s21c1
Sequence:CCGGAGAAGAAGAGGTTGAGTTAAACTCGAGTTTAACTCAACCTCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273027    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-1174s21c1
Sequence:CCGGCCTGAAGAGCAGCTTTACAGCCTCGAGGCTGTAAAGCTGCTCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-1073s21c1
Sequence:CCGGTGTGACACAGTGGAGCAATACCTCGAGGTATTGCTCCACTGTGTCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009736.2-844s21c1
Sequence:CCGGCCACCTGCAAGAATTGAATAACTCGAGTTATTCAATTCTTGCAGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009736.2-995s21c1
Sequence:CCGGGTCCTACCAGAACAATTTAAACTCGAGTTTAAATTGTTCTGGTAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks