EMAIL THIS PAGE TO A FRIEND

BAG2

BCL2-associated athanogene 2

55 Gene Product Result for
Synonyms: BAG-2 dJ417I1.2
UniProtKB ID: O95816, Q08AS9, Q6FID0
Gene ID:
Human(9532) Summary: BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The predicted BAG2 protein contains 211 amino acids. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
Mouse(213539) BCL2-associated athanogene 2
Rat(690038) Bcl2-associated athanogene 2
domestic guinea pig(100726997) BCL2-associated athanogene 2
naked mole-rat(101718309) BCL2-associated athanogene 2
Zebrafish(393975) BCL2-associated athanogene 2
cow(506107) BCL2-associated athanogene 2
domestic cat(101100209) BCL2-associated athanogene 2
dog(610506) BCL2-associated athanogene 2
chicken(421880) BCL2-associated athanogene 2
Thale Cress(836330) BCL-2-associated athanogene 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145392 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145392 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145392 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004282 Rosetta Predictions human pricing
NM_001128195 Rosetta Predictions rat pricing
NM_145392 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00106746 predicted 709
2 SASI_Hs01_00106747 predicted 780
3 SASI_Hs01_00106748 predicted 885
4 SASI_Hs01_00106749 predicted 435
5 SASI_Hs01_00106750 predicted 802
6 SASI_Hs02_00337269 predicted 292
7 SASI_Hs01_00106753 predicted 518
8 SASI_Hs01_00106754 predicted 567
9 SASI_Hs01_00106755 predicted 812
10 SASI_Hs02_00337270 predicted 714
11 SASI_Hs01_00106751 predicted 399
12 SASI_Hs01_00106752 predicted 549
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001128195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00255130 predicted 288
2 SASI_Rn02_00255131 predicted 1132
3 SASI_Rn02_00255132 predicted 622
4 SASI_Rn02_00255133 predicted 595
5 SASI_Rn02_00255134 predicted 597
6 SASI_Rn02_00255135 predicted 419
7 SASI_Rn02_00255136 predicted 571
8 SASI_Rn02_00255137 predicted 562
9 SASI_Rn02_00255138 predicted 571
10 SASI_Rn02_00255139 predicted 246
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145392 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170556 predicted 677
2 SASI_Mm02_00340719 predicted 612
3 SASI_Mm01_00170557 predicted 602
4 SASI_Mm01_00170558 predicted 448
5 SASI_Mm01_00170559 predicted 621
6 SASI_Mm01_00170561 predicted 506
7 SASI_Mm01_00170562 predicted 658
8 SASI_Mm01_00170564 predicted 288
9 SASI_Mm01_00170565 predicted 585
10 SASI_Mm02_00340720 predicted 441
11 SASI_Mm01_00170560 predicted 254
12 SASI_Mm01_00170563 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004282
VALIDATED
BAG2 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-1252s21c1
Sequence:CCGGGTACTAGGATCTAGCATATTTCTCGAGAAATATGCTAGATCCTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-670s21c1
Sequence:CCGGCCGTTGAAGTGTCAGTAGAAACTCGAGTTTCTACTGACACTTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-846s21c1
Sequence:CCGGGATCAGAAGTTTCAATCCATACTCGAGTATGGATTGAAACTTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-952s21c1
Sequence:CCGGCCATCAAGCTATTAGAGCATTCTCGAGAATGCTCTAATAGCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-724s21c1
Sequence:CCGGAGCATGCCACAAGGATTATTGCTCGAGCAATAATCCTTGTGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004282.2-719s1c1
Sequence:CCGGCCATCAAGCTATTAGAGCATTCTCGAGAATGCTCTAATAGCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004282.2-613s1c1
Sequence:CCGGGATCAGAAGTTTCAATCCATACTCGAGTATGGATTGAAACTTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004282.2-517s1c1
Sequence:CCGGGTGGTCAATAAGTTTCTGGATCTCGAGATCCAGAAACTTATTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004282.2-313s1c1
Sequence:CCGGGAGAAAGAAATCCTTCTGGAACTCGAGTTCCAGAAGGATTTCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004282.2-437s1c1
Sequence:CCGGCCGTTGAAGTGTCAGTAGAAACTCGAGTTTCTACTGACACTTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004282
VALIDATED
BAG2 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-1252s21c1
Sequence:CCGGGTACTAGGATCTAGCATATTTCTCGAGAAATATGCTAGATCCTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-670s21c1
Sequence:CCGGCCGTTGAAGTGTCAGTAGAAACTCGAGTTTCTACTGACACTTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-846s21c1
Sequence:CCGGGATCAGAAGTTTCAATCCATACTCGAGTATGGATTGAAACTTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-952s21c1
Sequence:CCGGCCATCAAGCTATTAGAGCATTCTCGAGAATGCTCTAATAGCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-724s21c1
Sequence:CCGGAGCATGCCACAAGGATTATTGCTCGAGCAATAATCCTTGTGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004282.2-719s1c1
Sequence:CCGGCCATCAAGCTATTAGAGCATTCTCGAGAATGCTCTAATAGCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004282.2-613s1c1
Sequence:CCGGGATCAGAAGTTTCAATCCATACTCGAGTATGGATTGAAACTTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004282.2-517s1c1
Sequence:CCGGGTGGTCAATAAGTTTCTGGATCTCGAGATCCAGAAACTTATTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004282.2-313s1c1
Sequence:CCGGGAGAAAGAAATCCTTCTGGAACTCGAGTTCCAGAAGGATTTCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004282.2-437s1c1
Sequence:CCGGCCGTTGAAGTGTCAGTAGAAACTCGAGTTTCTACTGACACTTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004282
VALIDATED
BAG2 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331267    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-1252s21c1
Sequence:CCGGGTACTAGGATCTAGCATATTTCTCGAGAAATATGCTAGATCCTAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-670s21c1
Sequence:CCGGCCGTTGAAGTGTCAGTAGAAACTCGAGTTTCTACTGACACTTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299787    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-846s21c1
Sequence:CCGGGATCAGAAGTTTCAATCCATACTCGAGTATGGATTGAAACTTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-952s21c1
Sequence:CCGGCCATCAAGCTATTAGAGCATTCTCGAGAATGCTCTAATAGCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_004282.3-724s21c1
Sequence:CCGGAGCATGCCACAAGGATTATTGCTCGAGCAATAATCCTTGTGGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_004282.2-719s1c1
Sequence:CCGGCCATCAAGCTATTAGAGCATTCTCGAGAATGCTCTAATAGCTTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004282.2-613s1c1
Sequence:CCGGGATCAGAAGTTTCAATCCATACTCGAGTATGGATTGAAACTTCTGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004282.2-517s1c1
Sequence:CCGGGTGGTCAATAAGTTTCTGGATCTCGAGATCCAGAAACTTATTGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004282.2-313s1c1
Sequence:CCGGGAGAAAGAAATCCTTCTGGAACTCGAGTTCCAGAAGGATTTCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033590    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_004282.2-437s1c1
Sequence:CCGGCCGTTGAAGTGTCAGTAGAAACTCGAGTTTCTACTGACACTTCAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145392
VALIDATED
BAG2 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145392.2-894s21c1
Sequence:CCGGCCCATCTTGAACTGGACTCTACTCGAGTAGAGTCCAGTTCAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145392.2-455s21c1
Sequence:CCGGGAGCCACTTAATGTCACTTTACTCGAGTAAAGTGACATTAAGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145392.2-665s21c1
Sequence:CCGGGCAGAACACTGACGGCAAATTCTCGAGAATTTGCCGTCAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145392.2-618s21c1
Sequence:CCGGGCCATTAAACTCCTAGAGCATCTCGAGATGCTCTAGGAGTTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-638s1c1
Sequence:CCGGGCCATTAAACTCCTAGAGCATCTCGAGATGCTCTAGGAGTTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145392.1-276s1c1
Sequence:CCGGGCCAGGACATGAGGCAGATTACTCGAGTAATCTGCCTCATGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-914s1c1
Sequence:CCGGCCCATCTTGAACTGGACTCTACTCGAGTAGAGTCCAGTTCAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-685s1c1
Sequence:CCGGGCAGAACACTGACGGCAAATTCTCGAGAATTTGCCGTCAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-475s1c1
Sequence:CCGGGAGCCACTTAATGTCACTTTACTCGAGTAAAGTGACATTAAGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145392
VALIDATED
BAG2 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145392.2-894s21c1
Sequence:CCGGCCCATCTTGAACTGGACTCTACTCGAGTAGAGTCCAGTTCAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145392.2-455s21c1
Sequence:CCGGGAGCCACTTAATGTCACTTTACTCGAGTAAAGTGACATTAAGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145392.2-665s21c1
Sequence:CCGGGCAGAACACTGACGGCAAATTCTCGAGAATTTGCCGTCAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145392.2-618s21c1
Sequence:CCGGGCCATTAAACTCCTAGAGCATCTCGAGATGCTCTAGGAGTTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-638s1c1
Sequence:CCGGGCCATTAAACTCCTAGAGCATCTCGAGATGCTCTAGGAGTTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145392.1-276s1c1
Sequence:CCGGGCCAGGACATGAGGCAGATTACTCGAGTAATCTGCCTCATGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-914s1c1
Sequence:CCGGCCCATCTTGAACTGGACTCTACTCGAGTAGAGTCCAGTTCAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-685s1c1
Sequence:CCGGGCAGAACACTGACGGCAAATTCTCGAGAATTTGCCGTCAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-475s1c1
Sequence:CCGGGAGCCACTTAATGTCACTTTACTCGAGTAAAGTGACATTAAGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145392
VALIDATED
BAG2 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325332    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145392.2-894s21c1
Sequence:CCGGCCCATCTTGAACTGGACTCTACTCGAGTAGAGTCCAGTTCAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145392.2-455s21c1
Sequence:CCGGGAGCCACTTAATGTCACTTTACTCGAGTAAAGTGACATTAAGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325259    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145392.2-665s21c1
Sequence:CCGGGCAGAACACTGACGGCAAATTCTCGAGAATTTGCCGTCAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145392.2-618s21c1
Sequence:CCGGGCCATTAAACTCCTAGAGCATCTCGAGATGCTCTAGGAGTTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-638s1c1
Sequence:CCGGGCCATTAAACTCCTAGAGCATCTCGAGATGCTCTAGGAGTTTAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145392.1-276s1c1
Sequence:CCGGGCCAGGACATGAGGCAGATTACTCGAGTAATCTGCCTCATGTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115171    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-914s1c1
Sequence:CCGGCCCATCTTGAACTGGACTCTACTCGAGTAGAGTCCAGTTCAAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-685s1c1
Sequence:CCGGGCAGAACACTGACGGCAAATTCTCGAGAATTTGCCGTCAGTGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145392.1-475s1c1
Sequence:CCGGGAGCCACTTAATGTCACTTTACTCGAGTAAAGTGACATTAAGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks