EMAIL THIS PAGE TO A FRIEND

BAG3

BCL2-associated athanogene 3

95 Gene Product Result for
Synonyms: BAG-3 BIS CAIR-1 MFM6
UniProtKB ID: O95817, A8K5L8, Q3B763, Q9NT20, Q9P120
Gene ID:
Human(9531) Summary: BAG proteins compete with Hip for binding to the Hsc70/Hsp70 ATPase domain and promote substrate release. All the BAG proteins have an approximately 45-amino acid BAG domain near the C terminus but differ markedly in their N-terminal regions. The protein encoded by this gene contains a WW domain in the N-terminal region and a BAG domain in the C-terminal region. The BAG domains of BAG1, BAG2, and BAG3 interact specifically with the Hsc70 ATPase domain in vitro and in mammalian cells. All 3 proteins bind with high affinity to the ATPase domain of Hsc70 and inhibit its chaperone activity in a Hip-repressible manner. [provided by RefSeq, Jul 2008]
Mouse(29810) BCL2-associated athanogene 3
Rat(293524) Bcl2-associated athanogene 3
Zebrafish(445139) BCL2-associated athanogene 3
chicken(423931) BCL2-associated athanogene 3
cow(782633) BCL2-associated athanogene 3
Horse(100065784) BCL2-associated athanogene 3
domestic cat(101094211) BCL2-associated athanogene 3
dog(486916) BCL2-associated athanogene 3
Thale Cress(830613) BCL-2-associated athanogene 3
naked mole-rat(101716547) BCL2-associated athanogene 3
domestic guinea pig(100715844) BCL2-associated athanogene 3
sheep(101108530) BCL2-associated athanogene 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013863 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013863 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013863 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004281 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004281 Rosetta Predictions human pricing
NM_001011936 Rosetta Predictions rat pricing
XM_574570 Rosetta Predictions rat pricing
NM_013863 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337266 predicted 1327
2 SASI_Hs01_00126956 predicted 1653
3 SASI_Hs01_00126957 predicted 1760
4 SASI_Hs01_00126958 predicted 2233
5 SASI_Hs01_00126959 predicted 2065
6 SASI_Hs02_00337267 predicted 1790
7 SASI_Hs02_00337268 predicted 1237
8 SASI_Hs01_00126961 predicted 2141
9 SASI_Hs01_00126962 predicted 1290
10 SASI_Hs01_00126963 predicted 1838
11 SASI_Hs01_00126955 predicted 1336
12 SASI_Hs01_00126960 predicted 1802
13 SASI_Hs01_00126964 predicted 1317
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011936 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064099 predicted 1178
2 SASI_Rn01_00064100 predicted 2016
3 SASI_Rn02_00199950 predicted 1089
4 SASI_Rn01_00064103 predicted 1718
5 SASI_Rn01_00064104 predicted 1953
6 SASI_Rn02_00199951 predicted 1959
7 SASI_Rn01_00064105 predicted 1556
8 SASI_Rn01_00064107 predicted 1596
9 SASI_Rn01_00064108 predicted 1968
10 SASI_Rn02_00199952 predicted 1696
11 SASI_Rn01_00064101 predicted 528
12 SASI_Rn01_00064102 predicted 1459
13 SASI_Rn01_00064106 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574570 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00193308 predicted 1345
2 SASI_Rn01_00193309 predicted 2178
3 SASI_Rn01_00193310 predicted 697
4 SASI_Rn01_00193311 predicted 1624
5 SASI_Rn01_00193312 predicted 1879
6 SASI_Rn01_00193313 predicted 2117
7 SASI_Rn01_00193314 predicted 1730
8 SASI_Rn01_00193315 predicted 1066
9 SASI_Rn01_00193316 predicted 1755
10 SASI_Rn01_00193317 predicted 2135
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013863 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085451 predicted 2073
2 SASI_Mm01_00085452 predicted 1033
3 SASI_Mm01_00085453 predicted 2070
4 SASI_Mm01_00085454 predicted 730
5 SASI_Mm01_00085455 predicted 2110
6 SASI_Mm01_00085456 predicted 1551
7 SASI_Mm01_00085458 predicted 2106
8 SASI_Mm02_00322879 predicted 1690
9 SASI_Mm01_00085459 predicted 895
10 SASI_Mm02_00322880 predicted 1688
11 SASI_Mm01_00085457 predicted 2125
12 SASI_Mm01_00085460 predicted 2048
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013863
VALIDATED
BAG3 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013863.3-2060s1c1
Sequence:CCGGCCACTTGGTATGCAGTAACTTCTCGAGAAGTTACTGCATACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013863.3-1762s1c1
Sequence:CCGGCCAGGTCAAGTACAAGTCTATCTCGAGATAGACTTGTACTTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013863.3-1585s1c1
Sequence:CCGGGAAGGCAAGAAGACTGATAAACTCGAGTTTATCAGTCTTCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013863.3-990s1c1
Sequence:CCGGGCAGCCTGTATACCACAAGATCTCGAGATCTTGTGGTATACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013863.3-886s1c1
Sequence:CCGGCCCGTGATACATGAGCAGAATCTCGAGATTCTGCTCATGTATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1196s21c1
Sequence:CCGGAGGTCTCCTCTGCTCCAATTCCTCGAGGAATTGGAGCAGAGGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1688s21c1
Sequence:CCGGTAGCCGACAAGGATAAGAAAGCTCGAGCTTTCTTATCCTTGTCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-2115s21c1
Sequence:CCGGGCTATCTGGGTGCAATGATTTCTCGAGAAATCATTGCACCCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1429s21c1
Sequence:CCGGGAAGGCAAGAAGACTGATAAACTCGAGTTTATCAGTCTTCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1454s21c1
Sequence:CCGGACCTGATGATCGAAGAGTATTCTCGAGAATACTCTTCGATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013863
VALIDATED
BAG3 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013863.3-2060s1c1
Sequence:CCGGCCACTTGGTATGCAGTAACTTCTCGAGAAGTTACTGCATACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013863.3-1762s1c1
Sequence:CCGGCCAGGTCAAGTACAAGTCTATCTCGAGATAGACTTGTACTTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013863.3-1585s1c1
Sequence:CCGGGAAGGCAAGAAGACTGATAAACTCGAGTTTATCAGTCTTCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013863.3-990s1c1
Sequence:CCGGGCAGCCTGTATACCACAAGATCTCGAGATCTTGTGGTATACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013863.3-886s1c1
Sequence:CCGGCCCGTGATACATGAGCAGAATCTCGAGATTCTGCTCATGTATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1196s21c1
Sequence:CCGGAGGTCTCCTCTGCTCCAATTCCTCGAGGAATTGGAGCAGAGGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1688s21c1
Sequence:CCGGTAGCCGACAAGGATAAGAAAGCTCGAGCTTTCTTATCCTTGTCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-2115s21c1
Sequence:CCGGGCTATCTGGGTGCAATGATTTCTCGAGAAATCATTGCACCCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1429s21c1
Sequence:CCGGGAAGGCAAGAAGACTGATAAACTCGAGTTTATCAGTCTTCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1454s21c1
Sequence:CCGGACCTGATGATCGAAGAGTATTCTCGAGAATACTCTTCGATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013863
VALIDATED
BAG3 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115436    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013863.3-2060s1c1
Sequence:CCGGCCACTTGGTATGCAGTAACTTCTCGAGAAGTTACTGCATACCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115438    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013863.3-1762s1c1
Sequence:CCGGCCAGGTCAAGTACAAGTCTATCTCGAGATAGACTTGTACTTGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013863.3-1585s1c1
Sequence:CCGGGAAGGCAAGAAGACTGATAAACTCGAGTTTATCAGTCTTCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115439    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013863.3-990s1c1
Sequence:CCGGGCAGCCTGTATACCACAAGATCTCGAGATCTTGTGGTATACAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115437    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013863.3-886s1c1
Sequence:CCGGCCCGTGATACATGAGCAGAATCTCGAGATTCTGCTCATGTATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307440    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1196s21c1
Sequence:CCGGAGGTCTCCTCTGCTCCAATTCCTCGAGGAATTGGAGCAGAGGAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1688s21c1
Sequence:CCGGTAGCCGACAAGGATAAGAAAGCTCGAGCTTTCTTATCCTTGTCGGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294880    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-2115s21c1
Sequence:CCGGGCTATCTGGGTGCAATGATTTCTCGAGAAATCATTGCACCCAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287382    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1429s21c1
Sequence:CCGGGAAGGCAAGAAGACTGATAAACTCGAGTTTATCAGTCTTCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013863.4-1454s21c1
Sequence:CCGGACCTGATGATCGAAGAGTATTCTCGAGAATACTCTTCGATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004281
VALIDATED
BAG3 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004281.2-2093s1c1
Sequence:CCGGGCATGCATTTCAGAGACTTTACTCGAGTAAAGTCTCTGAAATGCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004281.2-1786s1c1
Sequence:CCGGCTTGAACAGAAAGCCATTGATCTCGAGATCAATGGCTTTCTGTTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004281.2-1306s1c1
Sequence:CCGGCCTGGACACATCCCAATTCAACTCGAGTTGAATTGGGATGTGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004281.2-1633s1c1
Sequence:CCGGGAAGGCAAGAAGACTGACAAACTCGAGTTTGTCAGTCTTCTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004281.2-1318s1c1
Sequence:CCGGCCAATTCAAGTGATCCGCAAACTCGAGTTTGCGGATCACTTGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-2373s21c1
Sequence:CCGGTCAATTACCCATCACATAAATCTCGAGATTTATGTGATGGGTAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004281.3-920s21c1
Sequence:CCGGACATCTCCATTCCGGTGATACCTCGAGGTATCACCGGAATGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-1658s21c1
Sequence:CCGGACCTGATGATCGAAGAGTATTCTCGAGAATACTCTTCGATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-1786s21c1
Sequence:CCGGCTTGAACAGAAAGCCATTGATCTCGAGATCAATGGCTTTCTGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-1633s21c1
Sequence:CCGGGAAGGCAAGAAGACTGACAAACTCGAGTTTGTCAGTCTTCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004281
VALIDATED
BAG3 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004281.2-2093s1c1
Sequence:CCGGGCATGCATTTCAGAGACTTTACTCGAGTAAAGTCTCTGAAATGCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004281.2-1786s1c1
Sequence:CCGGCTTGAACAGAAAGCCATTGATCTCGAGATCAATGGCTTTCTGTTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004281.2-1306s1c1
Sequence:CCGGCCTGGACACATCCCAATTCAACTCGAGTTGAATTGGGATGTGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004281.2-1633s1c1
Sequence:CCGGGAAGGCAAGAAGACTGACAAACTCGAGTTTGTCAGTCTTCTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004281.2-1318s1c1
Sequence:CCGGCCAATTCAAGTGATCCGCAAACTCGAGTTTGCGGATCACTTGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-2373s21c1
Sequence:CCGGTCAATTACCCATCACATAAATCTCGAGATTTATGTGATGGGTAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004281.3-920s21c1
Sequence:CCGGACATCTCCATTCCGGTGATACCTCGAGGTATCACCGGAATGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-1658s21c1
Sequence:CCGGACCTGATGATCGAAGAGTATTCTCGAGAATACTCTTCGATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-1786s21c1
Sequence:CCGGCTTGAACAGAAAGCCATTGATCTCGAGATCAATGGCTTTCTGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-1633s21c1
Sequence:CCGGGAAGGCAAGAAGACTGACAAACTCGAGTTTGTCAGTCTTCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004281
VALIDATED
BAG3 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007290    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004281.2-2093s1c1
Sequence:CCGGGCATGCATTTCAGAGACTTTACTCGAGTAAAGTCTCTGAAATGCATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004281.2-1786s1c1
Sequence:CCGGCTTGAACAGAAAGCCATTGATCTCGAGATCAATGGCTTTCTGTTCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004281.2-1306s1c1
Sequence:CCGGCCTGGACACATCCCAATTCAACTCGAGTTGAATTGGGATGTGTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004281.2-1633s1c1
Sequence:CCGGGAAGGCAAGAAGACTGACAAACTCGAGTTTGTCAGTCTTCTTGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004281.2-1318s1c1
Sequence:CCGGCCAATTCAAGTGATCCGCAAACTCGAGTTTGCGGATCACTTGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293370    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-2373s21c1
Sequence:CCGGTCAATTACCCATCACATAAATCTCGAGATTTATGTGATGGGTAATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293299    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004281.3-920s21c1
Sequence:CCGGACATCTCCATTCCGGTGATACCTCGAGGTATCACCGGAATGGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-1658s21c1
Sequence:CCGGACCTGATGATCGAAGAGTATTCTCGAGAATACTCTTCGATCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293298    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-1786s21c1
Sequence:CCGGCTTGAACAGAAAGCCATTGATCTCGAGATCAATGGCTTTCTGTTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004281.3-1633s21c1
Sequence:CCGGGAAGGCAAGAAGACTGACAAACTCGAGTTTGTCAGTCTTCTTGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks