EMAIL THIS PAGE TO A FRIEND

BAG4

BCL2-associated athanogene 4

108 Gene Product Result for
Synonyms: BAG-4 SODD
UniProtKB ID: O95429, B4E217, O95818
Gene ID:
Human(9530) Summary: The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. This protein was found to be associated with the death domain of tumor necrosis factor receptor type 1 (TNF-R1) and death receptor-3 (DR3), and thereby negatively regulates downstream cell death signaling. The regulatory role of this protein in cell death was demonstrated in epithelial cells which undergo apoptosis while integrin mediated matrix contacts are lost. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Mar 2011]
Mouse(67384) BCL2-associated athanogene 4
Rat(361167) BCL2-associated athanogene 4
sheep(101118503) BCL2-associated athanogene 4
domestic guinea pig(100731898) BCL2-associated athanogene 4
naked mole-rat(101707505) BCL2-associated athanogene 4
Zebrafish(100001980) BCL2-associated athanogene 4
Thale Cress(824341) BCL-2-associated athanogene 4
domestic cat(101087659) BCL2-associated athanogene 4
cow(516353) BCL2-associated athanogene 4
Horse(100057730) BCL2-associated athanogene 4
dog(607954) BCL2-associated athanogene 4
chicken(426776) BCL2-associated athanogene 4
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004874 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026121 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026121 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026121 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004874 Rosetta Predictions human pricing
NM_001025130 Rosetta Predictions rat pricing
NM_026121 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158166 predicted 892
2 SASI_Hs01_00158167 predicted 607
3 SASI_Hs01_00158168 predicted 949
4 SASI_Hs02_00338505 predicted 736
5 SASI_Hs01_00158169 predicted 564
6 SASI_Hs02_00338506 predicted 558
7 SASI_Hs01_00158170 predicted 379
8 SASI_Hs01_00158171 predicted 613
9 SASI_Hs01_00158174 predicted 1262
10 SASI_Hs01_00158175 predicted 1195
11 SASI_Hs01_00158172 predicted 776
12 SASI_Hs01_00158173 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025130 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102611 predicted 1553
2 SASI_Rn01_00102612 predicted 1719
3 SASI_Rn01_00102613 predicted 1708
4 SASI_Rn01_00102614 predicted 593
5 SASI_Rn01_00102615 predicted 1385
6 SASI_Rn01_00102616 predicted 1617
7 SASI_Rn01_00102617 predicted 1070
8 SASI_Rn02_00203051 predicted 1230
9 SASI_Rn01_00102618 predicted 1045
10 SASI_Rn01_00102619 predicted 796
11 SASI_Rn01_00102620 predicted 711
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026121 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00065806 predicted 489
2 SASI_Mm01_00065807 predicted 1505
3 SASI_Mm01_00065808 predicted 1224
4 SASI_Mm01_00065809 predicted 1106
5 SASI_Mm02_00329701 predicted 500
6 SASI_Mm01_00065810 predicted 321
7 SASI_Mm01_00065811 predicted 312
8 SASI_Mm01_00065812 predicted 1453
9 SASI_Mm01_00065813 predicted 521
10 SASI_Mm01_00065814 predicted 1217
11 SASI_Mm01_00065815 predicted 1403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004874
BAG4 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004874.2-1866s21c1
Sequence:CCGGGAAACTATGGAGTTACCAATACTCGAGTATTGGTAACTCCATAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004874.2-781s21c1
Sequence:CCGGACAGAAGTTCCAAGTACTTACCTCGAGGTAAGTACTTGGAACTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004874.2-1960s21c1
Sequence:CCGGCACTTCACACAACAGGCTTATCTCGAGATAAGCCTGTTGTGTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-1349s1c1
Sequence:CCGGCCAACAATCAAGATCAAAGTACTCGAGTACTTTGATCTTGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-1229s1c1
Sequence:CCGGGCAGTGTCCATCAGTACGAATCTCGAGATTCGTACTGATGGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-568s1c1
Sequence:CCGGCCTAGCTACAATTCTAACTATCTCGAGATAGTTAGAATTGTAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-742s1c1
Sequence:CCGGGCTTATTATGCACCTGGTTATCTCGAGATAACCAGGTGCATAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-1606s1c1
Sequence:CCGGGTTTGTAAGATTCAGGCCATACTCGAGTATGGCCTGAATCTTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004874
BAG4 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004874.2-1866s21c1
Sequence:CCGGGAAACTATGGAGTTACCAATACTCGAGTATTGGTAACTCCATAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004874.2-781s21c1
Sequence:CCGGACAGAAGTTCCAAGTACTTACCTCGAGGTAAGTACTTGGAACTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004874.2-1960s21c1
Sequence:CCGGCACTTCACACAACAGGCTTATCTCGAGATAAGCCTGTTGTGTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-1349s1c1
Sequence:CCGGCCAACAATCAAGATCAAAGTACTCGAGTACTTTGATCTTGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-1229s1c1
Sequence:CCGGGCAGTGTCCATCAGTACGAATCTCGAGATTCGTACTGATGGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-568s1c1
Sequence:CCGGCCTAGCTACAATTCTAACTATCTCGAGATAGTTAGAATTGTAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-742s1c1
Sequence:CCGGGCTTATTATGCACCTGGTTATCTCGAGATAACCAGGTGCATAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-1606s1c1
Sequence:CCGGGTTTGTAAGATTCAGGCCATACTCGAGTATGGCCTGAATCTTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004874
BAG4 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435999    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004874.2-1866s21c1
Sequence:CCGGGAAACTATGGAGTTACCAATACTCGAGTATTGGTAACTCCATAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434291    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004874.2-781s21c1
Sequence:CCGGACAGAAGTTCCAAGTACTTACCTCGAGGTAAGTACTTGGAACTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004874.2-1960s21c1
Sequence:CCGGCACTTCACACAACAGGCTTATCTCGAGATAAGCCTGTTGTGTGAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-1349s1c1
Sequence:CCGGCCAACAATCAAGATCAAAGTACTCGAGTACTTTGATCTTGATTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033585    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-1229s1c1
Sequence:CCGGGCAGTGTCCATCAGTACGAATCTCGAGATTCGTACTGATGGACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033586    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-568s1c1
Sequence:CCGGCCTAGCTACAATTCTAACTATCTCGAGATAGTTAGAATTGTAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-742s1c1
Sequence:CCGGGCTTATTATGCACCTGGTTATCTCGAGATAACCAGGTGCATAATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033588    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004874.2-1606s1c1
Sequence:CCGGGTTTGTAAGATTCAGGCCATACTCGAGTATGGCCTGAATCTTACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026121
VALIDATED
BAG4 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000287861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1493s21c1
Sequence:CCGGGCCTGTTGTGACAAGAAGCAACTCGAGTTGCTTCTTGTCACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-985s21c1
Sequence:CCGGGCAGCGTCCATCAGTATGAATCTCGAGATTCATACTGATGGACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1159s21c1
Sequence:CCGGAGGGCACTCCTCCAAGTATTACTCGAGTAATACTTGGAGGAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1043s21c1
Sequence:CCGGGGATTCTCAAGTCCAGTATAGCTCGAGCTATACTGGACTTGAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1068s21c1
Sequence:CCGGGAGCCTCAGTTATATGGTAATCTCGAGATTACCATATAACTGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026121.1-1484s1c1
Sequence:CCGGGCCTGTTGTGACAAGAAGCAACTCGAGTTGCTTCTTGTCACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026121.1-976s1c1
Sequence:CCGGGCAGCGTCCATCAGTATGAATCTCGAGATTCATACTGATGGACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026121.1-489s1c1
Sequence:CCGGGCTTACTATGTACCTGGCTATCTCGAGATAGCCAGGTACATAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026121.1-1110s1c1
Sequence:CCGGCCGAGTAATAATCTCCCAGAACTCGAGTTCTGGGAGATTATTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026121.1-308s1c1
Sequence:CCGGGCCACCATATCCTGGCTATAACTCGAGTTATAGCCAGGATATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026121
VALIDATED
BAG4 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000287861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1493s21c1
Sequence:CCGGGCCTGTTGTGACAAGAAGCAACTCGAGTTGCTTCTTGTCACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-985s21c1
Sequence:CCGGGCAGCGTCCATCAGTATGAATCTCGAGATTCATACTGATGGACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1159s21c1
Sequence:CCGGAGGGCACTCCTCCAAGTATTACTCGAGTAATACTTGGAGGAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1043s21c1
Sequence:CCGGGGATTCTCAAGTCCAGTATAGCTCGAGCTATACTGGACTTGAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1068s21c1
Sequence:CCGGGAGCCTCAGTTATATGGTAATCTCGAGATTACCATATAACTGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026121.1-1484s1c1
Sequence:CCGGGCCTGTTGTGACAAGAAGCAACTCGAGTTGCTTCTTGTCACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026121.1-976s1c1
Sequence:CCGGGCAGCGTCCATCAGTATGAATCTCGAGATTCATACTGATGGACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026121.1-489s1c1
Sequence:CCGGGCTTACTATGTACCTGGCTATCTCGAGATAGCCAGGTACATAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026121.1-1110s1c1
Sequence:CCGGCCGAGTAATAATCTCCCAGAACTCGAGTTCTGGGAGATTATTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026121.1-308s1c1
Sequence:CCGGGCCACCATATCCTGGCTATAACTCGAGTTATAGCCAGGATATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026121
VALIDATED
BAG4 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000287861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1493s21c1
Sequence:CCGGGCCTGTTGTGACAAGAAGCAACTCGAGTTGCTTCTTGTCACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-985s21c1
Sequence:CCGGGCAGCGTCCATCAGTATGAATCTCGAGATTCATACTGATGGACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295234    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1159s21c1
Sequence:CCGGAGGGCACTCCTCCAAGTATTACTCGAGTAATACTTGGAGGAGTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1043s21c1
Sequence:CCGGGGATTCTCAAGTCCAGTATAGCTCGAGCTATACTGGACTTGAGAATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307510    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026121.3-1068s21c1
Sequence:CCGGGAGCCTCAGTTATATGGTAATCTCGAGATTACCATATAACTGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115201    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026121.1-1484s1c1
Sequence:CCGGGCCTGTTGTGACAAGAAGCAACTCGAGTTGCTTCTTGTCACAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115204    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026121.1-976s1c1
Sequence:CCGGGCAGCGTCCATCAGTATGAATCTCGAGATTCATACTGATGGACGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026121.1-489s1c1
Sequence:CCGGGCTTACTATGTACCTGGCTATCTCGAGATAGCCAGGTACATAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026121.1-1110s1c1
Sequence:CCGGCCGAGTAATAATCTCCCAGAACTCGAGTTCTGGGAGATTATTACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026121.1-308s1c1
Sequence:CCGGGCCACCATATCCTGGCTATAACTCGAGTTATAGCCAGGATATGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks