EMAIL THIS PAGE TO A FRIEND

BAG5

BCL2-associated athanogene 5

87 Gene Product Result for
Synonyms: BAG-5
UniProtKB ID: Q9UL15, O94950, Q86W59
Gene ID:
Human(9529) Summary: The protein encoded by this gene is a member of the BAG1-related protein family. BAG1 is an anti-apoptotic protein that functions through interactions with a variety of cell apoptosis and growth related proteins including BCL-2, Raf-protein kinase, steroid hormone receptors, growth factor receptors and members of the heat shock protein 70 kDa family. This protein contains a BAG domain near the C-terminus, which could bind and inhibit the chaperone activity of Hsc70/Hsp70. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(70369) BCL2-associated athanogene 5
Rat(366734) BCL2-associated athanogene 5
Zebrafish(569580) BCL2-associated athanogene 5
Thale Cress(837758) BCL-2-associated athanogene 5
cow(522854) BCL2-associated athanogene 5
Horse(100146239) BCL2-associated athanogene 5
domestic cat(101098875) BCL2-associated athanogene 5
dog(480444) BCL2-associated athanogene 5
chicken(423482) BCL2-associated athanogene 5
naked mole-rat(101711718) BCL2-associated athanogene 5
domestic guinea pig(100722501) BCL2-associated athanogene 5
sheep(101105952) BCL2-associated athanogene 5
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027404 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027404 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027404 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001015048 Rosetta Predictions human pricing
NM_001015049 Rosetta Predictions human pricing
NM_004873 Rosetta Predictions human pricing
NM_001008526 Rosetta Predictions rat pricing
NM_027404 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015048 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00170075 predicted 1381
2 SASI_Hs01_00170076 predicted 1316
3 SASI_Hs01_00170077 predicted 1479
4 SASI_Hs01_00170078 predicted 1233
5 SASI_Hs02_00306638 predicted 457
6 SASI_Hs01_00170079 predicted 940
7 SASI_Hs01_00170080 predicted 1528
8 SASI_Hs01_00170081 predicted 826
9 SASI_Hs01_00170082 predicted 1121
10 SASI_Hs01_00170083 predicted 572
11 SASI_Hs01_00170084 predicted 670
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001015049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093584 predicted 1550
2 SASI_Hs01_00093585 predicted 1482
3 SASI_Hs01_00093586 predicted 1646
4 SASI_Hs01_00093587 predicted 1403
5 SASI_Hs02_00306639 predicted 622
6 SASI_Hs01_00093588 predicted 1104
7 SASI_Hs01_00093589 predicted 1695
8 SASI_Hs01_00093590 predicted 998
9 SASI_Hs01_00093591 predicted 1288
10 SASI_Hs01_00093592 predicted 745
11 SASI_Hs01_00093593 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159543 predicted 1395
2 SASI_Hs01_00159544 predicted 1324
3 SASI_Hs01_00159545 predicted 1482
4 SASI_Hs01_00159546 predicted 1242
5 SASI_Hs02_00338504 predicted 464
6 SASI_Hs01_00159547 predicted 940
7 SASI_Hs01_00159548 predicted 1535
8 SASI_Hs01_00159549 predicted 840
9 SASI_Hs01_00159550 predicted 1127
10 SASI_Hs01_00159551 predicted 587
11 SASI_Hs01_00159552 predicted 675
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008526 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00102247 predicted 918
2 SASI_Rn01_00102248 predicted 872
3 SASI_Rn01_00102249 predicted 1223
4 SASI_Rn01_00102250 predicted 942
5 SASI_Rn02_00199216 predicted 1280
6 SASI_Rn01_00102251 predicted 931
7 SASI_Rn01_00102252 predicted 601
8 SASI_Rn01_00102253 predicted 552
9 SASI_Rn01_00102254 predicted 794
10 SASI_Rn01_00102255 predicted 704
11 SASI_Rn01_00102256 predicted 1571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027404 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042804 predicted 877
2 SASI_Mm01_00042805 predicted 378
3 SASI_Mm01_00042806 predicted 905
4 SASI_Mm01_00042807 predicted 1054
5 SASI_Mm01_00042808 predicted 886
6 SASI_Mm01_00042809 predicted 1045
7 SASI_Mm01_00042810 predicted 996
8 SASI_Mm01_00042811 predicted 986
9 SASI_Mm02_00332127 predicted 848
10 SASI_Mm01_00042812 predicted 731
11 SASI_Mm01_00042813 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027404
VALIDATED
BAG5 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-1645s1c1
Sequence:CCGGTCTCAGCTCATGGAGCCTAAACTCGAGTTTAGGCTCCATGAGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-952s1c1
Sequence:CCGGGCGTACAGAGATCAGAAATTACTCGAGTAATTTCTGATCTCTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-346s1c1
Sequence:CCGGCCTGTCGGATGACAAGAACTACTCGAGTAGTTCTTGTCATCCGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-557s1c1
Sequence:CCGGGCCCTTGTGAAAGACAAGATTCTCGAGAATCTTGTCTTTCACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-1417s1c1
Sequence:CCGGCCGAACTGATAAGAACTACATCTCGAGATGTAGTTCTTATCAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027404
VALIDATED
BAG5 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-1645s1c1
Sequence:CCGGTCTCAGCTCATGGAGCCTAAACTCGAGTTTAGGCTCCATGAGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-952s1c1
Sequence:CCGGGCGTACAGAGATCAGAAATTACTCGAGTAATTTCTGATCTCTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-346s1c1
Sequence:CCGGCCTGTCGGATGACAAGAACTACTCGAGTAGTTCTTGTCATCCGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-557s1c1
Sequence:CCGGGCCCTTGTGAAAGACAAGATTCTCGAGAATCTTGTCTTTCACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-1417s1c1
Sequence:CCGGCCGAACTGATAAGAACTACATCTCGAGATGTAGTTCTTATCAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027404
VALIDATED
BAG5 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115141    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-1645s1c1
Sequence:CCGGTCTCAGCTCATGGAGCCTAAACTCGAGTTTAGGCTCCATGAGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-952s1c1
Sequence:CCGGGCGTACAGAGATCAGAAATTACTCGAGTAATTTCTGATCTCTGTACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-346s1c1
Sequence:CCGGCCTGTCGGATGACAAGAACTACTCGAGTAGTTCTTGTCATCCGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-557s1c1
Sequence:CCGGGCCCTTGTGAAAGACAAGATTCTCGAGAATCTTGTCTTTCACAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_027404.1-1417s1c1
Sequence:CCGGCCGAACTGATAAGAACTACATCTCGAGATGTAGTTCTTATCAGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004873
VALIDATED
BAG5 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004873.1-493s1c1
Sequence:CCGGCCGGATTGAAATACAGAACATCTCGAGATGTTCTGTATTTCAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004873.1-1465s1c1
Sequence:CCGGGCAGGGAGAAGAGAAGTGTAACTCGAGTTACACTTCTCTTCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004873.1-1007s1c1
Sequence:CCGGGCAGACACAACTAAAGCATTTCTCGAGAAATGCTTTAGTTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004873.1-695s1c1
Sequence:CCGGGCGGTGCAAGAGATAATCGAACTCGAGTTCGATTATCTCTTGCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004873.1-926s1c1
Sequence:CCGGCGGACAGAAATCAGAAATTATCTCGAGATAATTTCTGATTTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-1316s21c1
Sequence:CCGGAGGAGCACCCATCCCATAAAGCTCGAGCTTTATGGGATGGGTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-937s21c1
Sequence:CCGGCGGACAGAAATCAGAAATTATCTCGAGATAATTTCTGATTTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-1018s21c1
Sequence:CCGGGCAGACACAACTAAAGCATTTCTCGAGAAATGCTTTAGTTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-706s21c1
Sequence:CCGGGCGGTGCAAGAGATAATCGAACTCGAGTTCGATTATCTCTTGCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004873.2-1741s21c1
Sequence:CCGGATATCATTACAGCACGTTAACCTCGAGGTTAACGTGCTGTAATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004873
VALIDATED
BAG5 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004873.1-493s1c1
Sequence:CCGGCCGGATTGAAATACAGAACATCTCGAGATGTTCTGTATTTCAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004873.1-1465s1c1
Sequence:CCGGGCAGGGAGAAGAGAAGTGTAACTCGAGTTACACTTCTCTTCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004873.1-1007s1c1
Sequence:CCGGGCAGACACAACTAAAGCATTTCTCGAGAAATGCTTTAGTTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004873.1-695s1c1
Sequence:CCGGGCGGTGCAAGAGATAATCGAACTCGAGTTCGATTATCTCTTGCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004873.1-926s1c1
Sequence:CCGGCGGACAGAAATCAGAAATTATCTCGAGATAATTTCTGATTTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-1316s21c1
Sequence:CCGGAGGAGCACCCATCCCATAAAGCTCGAGCTTTATGGGATGGGTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-937s21c1
Sequence:CCGGCGGACAGAAATCAGAAATTATCTCGAGATAATTTCTGATTTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-1018s21c1
Sequence:CCGGGCAGACACAACTAAAGCATTTCTCGAGAAATGCTTTAGTTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-706s21c1
Sequence:CCGGGCGGTGCAAGAGATAATCGAACTCGAGTTCGATTATCTCTTGCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004873.2-1741s21c1
Sequence:CCGGATATCATTACAGCACGTTAACCTCGAGGTTAACGTGCTGTAATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004873
VALIDATED
BAG5 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_004873.1-493s1c1
Sequence:CCGGCCGGATTGAAATACAGAACATCTCGAGATGTTCTGTATTTCAATCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004873.1-1465s1c1
Sequence:CCGGGCAGGGAGAAGAGAAGTGTAACTCGAGTTACACTTCTCTTCTCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004873.1-1007s1c1
Sequence:CCGGGCAGACACAACTAAAGCATTTCTCGAGAAATGCTTTAGTTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_004873.1-695s1c1
Sequence:CCGGGCGGTGCAAGAGATAATCGAACTCGAGTTCGATTATCTCTTGCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004873.1-926s1c1
Sequence:CCGGCGGACAGAAATCAGAAATTATCTCGAGATAATTTCTGATTTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303829    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-1316s21c1
Sequence:CCGGAGGAGCACCCATCCCATAAAGCTCGAGCTTTATGGGATGGGTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-937s21c1
Sequence:CCGGCGGACAGAAATCAGAAATTATCTCGAGATAATTTCTGATTTCTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-1018s21c1
Sequence:CCGGGCAGACACAACTAAAGCATTTCTCGAGAAATGCTTTAGTTGTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004873.2-706s21c1
Sequence:CCGGGCGGTGCAAGAGATAATCGAACTCGAGTTCGATTATCTCTTGCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303830    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004873.2-1741s21c1
Sequence:CCGGATATCATTACAGCACGTTAACCTCGAGGTTAACGTGCTGTAATGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks