EMAIL THIS PAGE TO A FRIEND

BAG6

BCL2-associated athanogene 6

113 Gene Product Result for
Synonyms: BAG-6 BAT3 D6S52E G3
Gene ID:
Human(7917) Summary: This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(224727) BCL2-associated athanogene 6
Rat(94342) BCL2-associated athanogene 6
sheep(100135439) BCL2-associated athanogene 6
Domestic Rabbit(100350337) BCL2-associated athanogene 6
domestic guinea pig(100721819) BCL2-associated athanogene 6
naked mole-rat(101710313) BCL2-associated athanogene 6
Zebrafish(83910) BCL2-associated athanogene 6
cow(508605) BCL2-associated athanogene 6
Horse(100050296) BCL2-associated athanogene 6
domestic cat(101086144) BCL2-associated athanogene 6
dog(474842) BCL2-associated athanogene 6
Thale Cress(819232) BCL-2-associated athanogene 6
Gene Class: ATPase
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004639 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004639 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004639 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_057171 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_057171 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_057171 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098534 Rosetta Predictions human pricing
NM_004639 Rosetta Predictions human pricing
NM_080702 Rosetta Predictions human pricing
NM_080703 Rosetta Predictions human pricing
NM_001033968 Rosetta Predictions rat pricing
NM_053609 Rosetta Predictions rat pricing
NM_057171 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098534 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319380 predicted 3183
2 SASI_Hs02_00319381 predicted 1089
3 SASI_Hs02_00319382 predicted 2928
4 SASI_Hs02_00319383 predicted 2945
5 SASI_Hs02_00319384 predicted 3190
6 SASI_Hs02_00319385 predicted 2827
7 SASI_Hs02_00319386 predicted 1631
8 SASI_Hs02_00319387 predicted 2813
9 SASI_Hs02_00319388 predicted 3214
10 SASI_Hs02_00319389 predicted 2432
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004639 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030742 predicted 2761
2 SASI_Hs01_00030743 predicted 3359
3 SASI_Hs02_00338045 predicted 2926
4 SASI_Hs01_00030747 predicted 3123
5 SASI_Hs01_00030748 predicted 3370
6 SASI_Hs01_00030749 predicted 2996
7 SASI_Hs01_00030750 predicted 2987
8 SASI_Hs01_00030751 predicted 3381
9 SASI_Hs02_00338046 predicted 2622
10 SASI_Hs02_00338047 predicted 2614
11 SASI_Hs01_00030744 predicted 2892
12 SASI_Hs01_00030745 predicted 2920
13 SASI_Hs01_00030746 predicted 3004
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087421 predicted 3317
2 SASI_Hs02_00362483 predicted 1220
3 SASI_Hs02_00362484 predicted 3061
4 SASI_Hs01_00087425 predicted 3080
5 SASI_Hs01_00087426 predicted 3322
6 SASI_Hs01_00087427 predicted 2962
7 SASI_Hs02_00362485 predicted 1754
8 SASI_Hs01_00087428 predicted 2939
9 SASI_Hs01_00087429 predicted 3344
10 SASI_Hs02_00362486 predicted 2569
11 SASI_Hs01_00087420 predicted 2696
12 SASI_Hs01_00087422 predicted 2852
13 SASI_Hs01_00087423 predicted 2871
14 SASI_Hs01_00087424 predicted 2954
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194313 predicted 3336
2 SASI_Hs01_00194316 predicted 1240
3 SASI_Hs01_00194317 predicted 3090
4 SASI_Hs01_00194319 predicted 3106
5 SASI_Hs01_00194320 predicted 3349
6 SASI_Hs01_00194321 predicted 2979
7 SASI_Hs01_00194322 predicted 1780
8 SASI_Hs02_00362487 predicted 2968
9 SASI_Hs02_00362488 predicted 3364
10 SASI_Hs02_00362489 predicted 2585
11 SASI_Hs01_00194314 predicted 2875
12 SASI_Hs01_00194315 predicted 2895
13 SASI_Hs01_00194318 predicted 2981
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033968 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00069593 predicted 2628
2 SASI_Rn01_00069594 predicted 501
3 SASI_Rn01_00069595 predicted 2739
4 SASI_Rn01_00069596 predicted 2311
5 SASI_Rn01_00069597 predicted 1089
6 SASI_Rn01_00069599 predicted 2857
7 SASI_Rn01_00069600 predicted 2582
8 SASI_Rn02_00203845 predicted 2699
9 SASI_Rn01_00069601 predicted 2941
10 SASI_Rn02_00203846 predicted 1944
11 SASI_Rn01_00069598 predicted 2661
12 SASI_Rn01_00069602 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053609 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00072366 predicted 2782
2 SASI_Rn01_00072368 predicted 663
3 SASI_Rn01_00072369 predicted 2900
4 SASI_Rn01_00072370 predicted 1244
5 SASI_Rn01_00072371 predicted 2813
6 SASI_Rn01_00072372 predicted 3011
7 SASI_Rn01_00072373 predicted 2742
8 SASI_Rn02_00266311 predicted 2852
9 SASI_Rn01_00072374 predicted 3104
10 SASI_Rn01_00072375 predicted 1256
11 SASI_Rn01_00072367 predicted 627
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057171 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338048 predicted 3349
2 SASI_Mm02_00338049 predicted 2796
3 SASI_Mm02_00338050 predicted 2906
4 SASI_Mm02_00338051 predicted 3114
5 SASI_Mm02_00338052 predicted 2754
6 SASI_Mm02_00338053 predicted 1242
7 SASI_Mm02_00338054 predicted 342
8 SASI_Mm02_00338055 predicted 3361
9 SASI_Mm02_00338056 predicted 3164
10 SASI_Mm02_00338057 predicted 1616
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004639
VALIDATED
BAG6 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000279975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-2991s21c1
Sequence:CCGGGCTGTTATCAATGGCCGAATTCTCGAGAATTCGGCCATTGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-382s21c1
Sequence:CCGGCCTTGGACTCTCAAACTCGTACTCGAGTACGAGTTTGAGAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-3372s21c1
Sequence:CCGGCCTATTATCCAGCAGGACATTCTCGAGAATGTCCTGCTGGATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-1434s21c1
Sequence:CCGGGCCATTCCCATACAGATCAATCTCGAGATTGATCTGTATGGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-2961s1c1
Sequence:CCGGGCTGTTATCAATGGCCGAATTCTCGAGAATTCGGCCATTGATAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-1404s1c1
Sequence:CCGGGCCATTCCCATACAGATCAATCTCGAGATTGATCTGTATGGGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004639.2-2450s1c1
Sequence:CCGGCAGTGAAAGTATTGCTGCCTTCTCGAGAAGGCAGCAATACTTTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-3342s1c1
Sequence:CCGGCCTATTATCCAGCAGGACATTCTCGAGAATGTCCTGCTGGATAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-352s1c1
Sequence:CCGGCCTTGGACTCTCAAACTCGTACTCGAGTACGAGTTTGAGAGTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004639
VALIDATED
BAG6 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000279975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-2991s21c1
Sequence:CCGGGCTGTTATCAATGGCCGAATTCTCGAGAATTCGGCCATTGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-382s21c1
Sequence:CCGGCCTTGGACTCTCAAACTCGTACTCGAGTACGAGTTTGAGAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-3372s21c1
Sequence:CCGGCCTATTATCCAGCAGGACATTCTCGAGAATGTCCTGCTGGATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-1434s21c1
Sequence:CCGGGCCATTCCCATACAGATCAATCTCGAGATTGATCTGTATGGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-2961s1c1
Sequence:CCGGGCTGTTATCAATGGCCGAATTCTCGAGAATTCGGCCATTGATAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-1404s1c1
Sequence:CCGGGCCATTCCCATACAGATCAATCTCGAGATTGATCTGTATGGGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004639.2-2450s1c1
Sequence:CCGGCAGTGAAAGTATTGCTGCCTTCTCGAGAAGGCAGCAATACTTTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-3342s1c1
Sequence:CCGGCCTATTATCCAGCAGGACATTCTCGAGAATGTCCTGCTGGATAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-352s1c1
Sequence:CCGGCCTTGGACTCTCAAACTCGTACTCGAGTACGAGTTTGAGAGTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004639
VALIDATED
BAG6 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000279975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-2991s21c1
Sequence:CCGGGCTGTTATCAATGGCCGAATTCTCGAGAATTCGGCCATTGATAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279905    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-382s21c1
Sequence:CCGGCCTTGGACTCTCAAACTCGTACTCGAGTACGAGTTTGAGAGTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-3372s21c1
Sequence:CCGGCCTATTATCCAGCAGGACATTCTCGAGAATGTCCTGCTGGATAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004639.3-1434s21c1
Sequence:CCGGGCCATTCCCATACAGATCAATCTCGAGATTGATCTGTATGGGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007353    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-2961s1c1
Sequence:CCGGGCTGTTATCAATGGCCGAATTCTCGAGAATTCGGCCATTGATAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-1404s1c1
Sequence:CCGGGCCATTCCCATACAGATCAATCTCGAGATTGATCTGTATGGGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004639.2-2450s1c1
Sequence:CCGGCAGTGAAAGTATTGCTGCCTTCTCGAGAAGGCAGCAATACTTTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-3342s1c1
Sequence:CCGGCCTATTATCCAGCAGGACATTCTCGAGAATGTCCTGCTGGATAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_004639.2-352s1c1
Sequence:CCGGCCTTGGACTCTCAAACTCGTACTCGAGTACGAGTTTGAGAGTCCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057171
VALIDATED
BAG6 MISSION shRNA Bacterial Glycerol Stock
BCL2-associated athanogene 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-392s21c1
Sequence:CCGGTCAGCATCCCTTCCGAGAAACCTCGAGGTTTCTCGGAAGGGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-2803s21c1
Sequence:CCGGGTGGATATCATCCGGACAAATCTCGAGATTTGTCCGGATGATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-3354s21c1
Sequence:CCGGCCCTGAATGGGTCCCTATTATCTCGAGATAATAGGGACCCATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-351s21c1
Sequence:CCGGGATGAATGTAAAGGAGTTTAACTCGAGTTAAACTCCTTTACATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057171.1-752s21c1
Sequence:CCGGAGCACATGATTAGGGATATACCTCGAGGTATATCCCTAATCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057171.1-1493s1c1
Sequence:CCGGCTTCCACCACTGTTGATTCATCTCGAGATGAATCAACAGTGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057171.1-2024s1c1
Sequence:CCGGCTTCAGCTAGTGCTGGTACTACTCGAGTAGTACCAGCACTAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057171.1-3449s1c1
Sequence:CCGGCTGCCAAGAGACGAAAGACAACTCGAGTTGTCTTTCGTCTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057171
VALIDATED
BAG6 MISSION shRNA shRNA Plasmid DNA
BCL2-associated athanogene 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-392s21c1
Sequence:CCGGTCAGCATCCCTTCCGAGAAACCTCGAGGTTTCTCGGAAGGGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-2803s21c1
Sequence:CCGGGTGGATATCATCCGGACAAATCTCGAGATTTGTCCGGATGATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-3354s21c1
Sequence:CCGGCCCTGAATGGGTCCCTATTATCTCGAGATAATAGGGACCCATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-351s21c1
Sequence:CCGGGATGAATGTAAAGGAGTTTAACTCGAGTTAAACTCCTTTACATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057171.1-752s21c1
Sequence:CCGGAGCACATGATTAGGGATATACCTCGAGGTATATCCCTAATCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057171.1-1493s1c1
Sequence:CCGGCTTCCACCACTGTTGATTCATCTCGAGATGAATCAACAGTGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057171.1-2024s1c1
Sequence:CCGGCTTCAGCTAGTGCTGGTACTACTCGAGTAGTACCAGCACTAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057171.1-3449s1c1
Sequence:CCGGCTGCCAAGAGACGAAAGACAACTCGAGTTGTCTTTCGTCTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057171
VALIDATED
BAG6 MISSION shRNA Lentiviral Transduction Particles
BCL2-associated athanogene 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-392s21c1
Sequence:CCGGTCAGCATCCCTTCCGAGAAACCTCGAGGTTTCTCGGAAGGGATGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249135    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-2803s21c1
Sequence:CCGGGTGGATATCATCCGGACAAATCTCGAGATTTGTCCGGATGATATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-3354s21c1
Sequence:CCGGCCCTGAATGGGTCCCTATTATCTCGAGATAATAGGGACCCATTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249134    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_057171.1-351s21c1
Sequence:CCGGGATGAATGTAAAGGAGTTTAACTCGAGTTAAACTCCTTTACATTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249137    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057171.1-752s21c1
Sequence:CCGGAGCACATGATTAGGGATATACCTCGAGGTATATCCCTAATCATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057171.1-1493s1c1
Sequence:CCGGCTTCCACCACTGTTGATTCATCTCGAGATGAATCAACAGTGGTGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174045    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057171.1-2024s1c1
Sequence:CCGGCTTCAGCTAGTGCTGGTACTACTCGAGTAGTACCAGCACTAGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173784    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_057171.1-3449s1c1
Sequence:CCGGCTGCCAAGAGACGAAAGACAACTCGAGTTGTCTTTCGTCTCTTGGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks