EMAIL THIS PAGE TO A FRIEND

BAGE2

B melanoma antigen family, member 2

29 Gene Product Result for
Synonyms: CT2.2
Species: Human BAGE2(85319)
UniProtKB ID: Q86Y30, A8K925, Q08ER0
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301877 Anti-BAGE2 affinity isolated antibody human
western blot pricing
SAB4301123 Anti-BAGE2 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182482 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182482 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182482 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU073191 MISSION® esiRNA esiRNA human MLL3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182482 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182482 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127321 predicted 831
2 SASI_Hs02_00370508 predicted 809
3 SASI_Hs02_00370509 predicted 797
4 SASI_Hs02_00370510 predicted 807
5 SASI_Hs02_00370511 predicted 797
6 SASI_Hs02_00370512 predicted 804
7 SASI_Hs02_00370513 predicted 798
8 SASI_Hs02_00370514 predicted 831
9 SASI_Hs02_00370515 predicted 800
10 SASI_Hs01_00127315 predicted 673
11 SASI_Hs01_00127316 predicted 760
12 SASI_Hs01_00127317 predicted 623
13 SASI_Hs01_00127318 predicted 583
14 SASI_Hs01_00127319 predicted 846
15 SASI_Hs01_00127320 predicted 1009
16 SASI_Hs01_00127322 predicted 530
17 SASI_Hs01_00127323 predicted 690
18 SASI_Hs01_00127324 predicted 748
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182482
BAGE2 MISSION shRNA Bacterial Glycerol Stock
B melanoma antigen family, member 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182482.1-1415s1c1
Sequence:CCGGGCATGGGTAAACCAGCTATTACTCGAGTAATAGCTGGTTTACCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168024    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182482.1-698s1c1
Sequence:CCGGCGTGTGACAAAGGGTATCATACTCGAGTATGATACCCTTTGTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182482.1-1074s1c1
Sequence:CCGGCCTGAGGAACAGTTGGTTATACTCGAGTATAACCAACTGTTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-478s1c1
Sequence:CCGGCCTGAAAGATCGAAGGAAGATCTCGAGATCTTCCTTCGATCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-423s1c1
Sequence:CCGGCTTTCAGGATTTCAGTCACATCTCGAGATGTGACTGAAATCCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-457s1c1
Sequence:CCGGCCAGAACACATTGACCAAGCTCTCGAGAGCTTGGTCAATGTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-485s1c1
Sequence:CCGGGATCGAAGGAAGATGCAAACTCTCGAGAGTTTGCATCTTCCTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-475s1c1
Sequence:CCGGGCTCCTGAAAGATCGAAGGAACTCGAGTTCCTTCGATCTTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-342s1c1
Sequence:CCGGGCACTTTGGAGCCACTATCAACTCGAGTTGATAGTGGCTCCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182482
BAGE2 MISSION shRNA shRNA Plasmid DNA
B melanoma antigen family, member 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182482.1-1415s1c1
Sequence:CCGGGCATGGGTAAACCAGCTATTACTCGAGTAATAGCTGGTTTACCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168024    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182482.1-698s1c1
Sequence:CCGGCGTGTGACAAAGGGTATCATACTCGAGTATGATACCCTTTGTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182482.1-1074s1c1
Sequence:CCGGCCTGAGGAACAGTTGGTTATACTCGAGTATAACCAACTGTTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-478s1c1
Sequence:CCGGCCTGAAAGATCGAAGGAAGATCTCGAGATCTTCCTTCGATCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-423s1c1
Sequence:CCGGCTTTCAGGATTTCAGTCACATCTCGAGATGTGACTGAAATCCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-457s1c1
Sequence:CCGGCCAGAACACATTGACCAAGCTCTCGAGAGCTTGGTCAATGTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-485s1c1
Sequence:CCGGGATCGAAGGAAGATGCAAACTCTCGAGAGTTTGCATCTTCCTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-475s1c1
Sequence:CCGGGCTCCTGAAAGATCGAAGGAACTCGAGTTCCTTCGATCTTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-342s1c1
Sequence:CCGGGCACTTTGGAGCCACTATCAACTCGAGTTGATAGTGGCTCCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182482
BAGE2 MISSION shRNA Lentiviral Transduction Particles
B melanoma antigen family, member 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168341    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182482.1-1415s1c1
Sequence:CCGGGCATGGGTAAACCAGCTATTACTCGAGTAATAGCTGGTTTACCCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168024    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182482.1-698s1c1
Sequence:CCGGCGTGTGACAAAGGGTATCATACTCGAGTATGATACCCTTTGTCACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168224    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182482.1-1074s1c1
Sequence:CCGGCCTGAGGAACAGTTGGTTATACTCGAGTATAACCAACTGTTCCTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-478s1c1
Sequence:CCGGCCTGAAAGATCGAAGGAAGATCTCGAGATCTTCCTTCGATCTTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-423s1c1
Sequence:CCGGCTTTCAGGATTTCAGTCACATCTCGAGATGTGACTGAAATCCTGAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173000    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-457s1c1
Sequence:CCGGCCAGAACACATTGACCAAGCTCTCGAGAGCTTGGTCAATGTGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168607    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-485s1c1
Sequence:CCGGGATCGAAGGAAGATGCAAACTCTCGAGAGTTTGCATCTTCCTTCGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172899    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-475s1c1
Sequence:CCGGGCTCCTGAAAGATCGAAGGAACTCGAGTTCCTTCGATCTTTCAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172937    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182482.1-342s1c1
Sequence:CCGGGCACTTTGGAGCCACTATCAACTCGAGTTGATAGTGGCTCCAAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks