EMAIL THIS PAGE TO A FRIEND

BAGE3

B melanoma antigen family, member 3

21 Gene Product Result for
Synonyms: CT2.3
Species: Human BAGE3(85318)
UniProtKB ID: Q86Y29
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301124 Anti-BAGE3 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182481 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182481 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182481 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182481 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182481 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00096479 predicted 829
2 SASI_Hs02_00370500 predicted 807
3 SASI_Hs02_00370501 predicted 796
4 SASI_Hs02_00370502 predicted 805
5 SASI_Hs02_00370503 predicted 802
6 SASI_Hs02_00370504 predicted 798
7 SASI_Hs02_00370505 predicted 797
8 SASI_Hs02_00370506 predicted 828
9 SASI_Hs02_00370507 predicted 800
10 SASI_Hs01_00096474 predicted 671
11 SASI_Hs01_00096475 predicted 621
12 SASI_Hs01_00096476 predicted 585
13 SASI_Hs01_00096477 predicted 851
14 SASI_Hs01_00096478 predicted 1005
15 SASI_Hs01_00096480 predicted 749
16 SASI_Hs01_00096481 predicted 522
17 SASI_Hs01_00096482 predicted 686
18 SASI_Hs01_00096483 predicted 927
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182481
BAGE3 MISSION shRNA Bacterial Glycerol Stock
B melanoma antigen family, member 3
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182481.1-1321s1c1
Sequence:CCGGCGCATGACATGCTGCATAATTCTCGAGAATTATGCAGCATGTCATGCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182481.1-481s1c1
Sequence:CCGGGAAAGATCGAAGGAAGATGCACTCGAGTGCATCTTCCTTCGATCTTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168060    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182481.1-759s1c1
Sequence:CCGGCGGCTGGAAATGCAAATGAATCTCGAGATTCATTTGCATTTCCAGCCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182481.1-1116s1c1
Sequence:CCGGGAACAGAAAGAAGATTCTGAACTCGAGTTCAGAATCTTCTTTCTGTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182481.1-385s1c1
Sequence:CCGGCAGATGTATCATTATCCTTGTCTCGAGACAAGGATAATGATACATCTGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182481.1-835s21c1
Sequence:CCGGCTTCTGAAGTGAAGCATATTTCTCGAGAAATATGCTTCACTTCAGAAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182481.1-344s21c1
Sequence:CCGGACTTTGGAGCCACTATCAAATCTCGAGATTTGATAGTGGCTCCAAAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182481.1-589s21c1
Sequence:CCGGGATATAGCGGTTACTCCATTACTCGAGTAATGGAGTAACCGCTATATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182481
BAGE3 MISSION shRNA shRNA Plasmid DNA
B melanoma antigen family, member 3
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182481.1-1321s1c1
Sequence:CCGGCGCATGACATGCTGCATAATTCTCGAGAATTATGCAGCATGTCATGCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182481.1-481s1c1
Sequence:CCGGGAAAGATCGAAGGAAGATGCACTCGAGTGCATCTTCCTTCGATCTTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168060    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182481.1-759s1c1
Sequence:CCGGCGGCTGGAAATGCAAATGAATCTCGAGATTCATTTGCATTTCCAGCCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182481.1-1116s1c1
Sequence:CCGGGAACAGAAAGAAGATTCTGAACTCGAGTTCAGAATCTTCTTTCTGTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000166864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182481.1-385s1c1
Sequence:CCGGCAGATGTATCATTATCCTTGTCTCGAGACAAGGATAATGATACATCTGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182481.1-835s21c1
Sequence:CCGGCTTCTGAAGTGAAGCATATTTCTCGAGAAATATGCTTCACTTCAGAAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182481.1-344s21c1
Sequence:CCGGACTTTGGAGCCACTATCAAATCTCGAGATTTGATAGTGGCTCCAAAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182481.1-589s21c1
Sequence:CCGGGATATAGCGGTTACTCCATTACTCGAGTAATGGAGTAACCGCTATATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182481
BAGE3 MISSION shRNA Lentiviral Transduction Particles
B melanoma antigen family, member 3
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168837    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182481.1-1321s1c1
Sequence:CCGGCGCATGACATGCTGCATAATTCTCGAGAATTATGCAGCATGTCATGCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182481.1-481s1c1
Sequence:CCGGGAAAGATCGAAGGAAGATGCACTCGAGTGCATCTTCCTTCGATCTTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168060    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182481.1-759s1c1
Sequence:CCGGCGGCTGGAAATGCAAATGAATCTCGAGATTCATTTGCATTTCCAGCCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167436    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182481.1-1116s1c1
Sequence:CCGGGAACAGAAAGAAGATTCTGAACTCGAGTTCAGAATCTTCTTTCTGTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000166864    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182481.1-385s1c1
Sequence:CCGGCAGATGTATCATTATCCTTGTCTCGAGACAAGGATAATGATACATCTGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182481.1-835s21c1
Sequence:CCGGCTTCTGAAGTGAAGCATATTTCTCGAGAAATATGCTTCACTTCAGAAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182481.1-344s21c1
Sequence:CCGGACTTTGGAGCCACTATCAAATCTCGAGATTTGATAGTGGCTCCAAAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371415    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182481.1-589s21c1
Sequence:CCGGGATATAGCGGTTACTCCATTACTCGAGTAATGGAGTAACCGCTATATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)