EMAIL THIS PAGE TO A FRIEND

BAGE4

B melanoma antigen family, member 4

15 Gene Product Result for
Synonyms: CT2.4 MLL3P
Species: Human BAGE4(85317)
UniProtKB ID: Q86Y28
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301125 Anti-BAGE4 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_181704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_181704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_181704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_181704 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237146 predicted 739
2 SASI_Hs01_00237147 predicted 685
3 SASI_Hs01_00237148 predicted 648
4 SASI_Hs01_00237150 predicted 786
5 SASI_Hs01_00237151 predicted 594
6 SASI_Hs01_00237153 predicted 697
7 SASI_Hs01_00237154 predicted 552
8 SASI_Hs01_00237155 predicted 717
9 SASI_Hs02_00370306 predicted 544
10 SASI_Hs02_00370307 predicted 763
11 SASI_Hs01_00237149 predicted 760
12 SASI_Hs01_00237152 predicted 758
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_181704
BAGE4 MISSION shRNA Bacterial Glycerol Stock
B melanoma antigen family, member 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181704.1-385s21c1
Sequence:CCGGGGCCAAGTGCGATGTGCATTTCTCGAGAAATGCACATCGCACTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181704.1-660s21c1
Sequence:CCGGTATAGCGGTTACTCCATTAAACTCGAGTTTAATGGAGTAACCGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181704.1-295s21c1
Sequence:CCGGGCACAGCTCTGTGATTCATCTCTCGAGAGATGAATCACAGAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168340    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-746s1c1
Sequence:CCGGGCAAGATGCTAGTGTGTGATACTCGAGTATCACACACTAGCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-547s1c1
Sequence:CCGGCCAGAAAGATCGAAGGAAGATCTCGAGATCTTCCTTCGATCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-864s1c1
Sequence:CCGGCAGATTTCTAATGAGGCTGATCTCGAGATCAGCCTCATTAGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173051    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-1612s1c1
Sequence:CCGGCGAGGCAAGTCAAAGCTGAAACTCGAGTTTCAGCTTTGACTTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-1013s1c1
Sequence:CCGGGCAGTTGTTAGAGGAACCTAACTCGAGTTAGGTTCCTCTAACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-725s1c1
Sequence:CCGGGCAAACAATCGGGAGAAGATACTCGAGTATCTTCTCCCGATTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_181704
BAGE4 MISSION shRNA shRNA Plasmid DNA
B melanoma antigen family, member 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181704.1-385s21c1
Sequence:CCGGGGCCAAGTGCGATGTGCATTTCTCGAGAAATGCACATCGCACTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181704.1-660s21c1
Sequence:CCGGTATAGCGGTTACTCCATTAAACTCGAGTTTAATGGAGTAACCGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181704.1-295s21c1
Sequence:CCGGGCACAGCTCTGTGATTCATCTCTCGAGAGATGAATCACAGAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168340    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-746s1c1
Sequence:CCGGGCAAGATGCTAGTGTGTGATACTCGAGTATCACACACTAGCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-547s1c1
Sequence:CCGGCCAGAAAGATCGAAGGAAGATCTCGAGATCTTCCTTCGATCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-864s1c1
Sequence:CCGGCAGATTTCTAATGAGGCTGATCTCGAGATCAGCCTCATTAGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173051    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-1612s1c1
Sequence:CCGGCGAGGCAAGTCAAAGCTGAAACTCGAGTTTCAGCTTTGACTTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-1013s1c1
Sequence:CCGGGCAGTTGTTAGAGGAACCTAACTCGAGTTAGGTTCCTCTAACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-725s1c1
Sequence:CCGGGCAAACAATCGGGAGAAGATACTCGAGTATCTTCTCCCGATTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_181704
BAGE4 MISSION shRNA Lentiviral Transduction Particles
B melanoma antigen family, member 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181704.1-385s21c1
Sequence:CCGGGGCCAAGTGCGATGTGCATTTCTCGAGAAATGCACATCGCACTTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371417    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_181704.1-660s21c1
Sequence:CCGGTATAGCGGTTACTCCATTAAACTCGAGTTTAATGGAGTAACCGCTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_181704.1-295s21c1
Sequence:CCGGGCACAGCTCTGTGATTCATCTCTCGAGAGATGAATCACAGAGCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168340    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-746s1c1
Sequence:CCGGGCAAGATGCTAGTGTGTGATACTCGAGTATCACACACTAGCATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168195    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-547s1c1
Sequence:CCGGCCAGAAAGATCGAAGGAAGATCTCGAGATCTTCCTTCGATCTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167251    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-864s1c1
Sequence:CCGGCAGATTTCTAATGAGGCTGATCTCGAGATCAGCCTCATTAGAAATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173051    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-1612s1c1
Sequence:CCGGCGAGGCAAGTCAAAGCTGAAACTCGAGTTTCAGCTTTGACTTGCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168767    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-1013s1c1
Sequence:CCGGGCAGTTGTTAGAGGAACCTAACTCGAGTTAGGTTCCTCTAACAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168695    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_181704.1-725s1c1
Sequence:CCGGGCAAACAATCGGGAGAAGATACTCGAGTATCTTCTCCCGATTGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks