EMAIL THIS PAGE TO A FRIEND

BAGE5

B melanoma antigen family, member 5

60 Gene Product Result for
Synonyms: CT2.5
Species: Human BAGE5(85316)
UniProtKB ID: Q86Y27
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182484 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182484 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182484 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU117941 MISSION® esiRNA esiRNA human BAGE2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182484 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182484 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00204898 predicted 736
2 SASI_Hs01_00204899 predicted 691
3 SASI_Hs01_00204900 predicted 652
4 SASI_Hs01_00204902 predicted 791
5 SASI_Hs01_00204903 predicted 592
6 SASI_Hs01_00204904 predicted 819
7 SASI_Hs01_00204906 predicted 700
8 SASI_Hs01_00204907 predicted 556
9 SASI_Hs02_00370517 predicted 724
10 SASI_Hs02_00370518 predicted 764
11 SASI_Hs01_00204901 predicted 764
12 SASI_Hs01_00204905 predicted 753
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182484
BAGE5 MISSION shRNA Bacterial Glycerol Stock
B melanoma antigen family, member 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000172796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-1434s1c1
Sequence:CCGGGCTGGAAACATCATGCCAACACTCGAGTGTTGGCATGATGTTTCCAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168639    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-757s1c1
Sequence:CCGGGTGTGTGATACGTGTGACAAACTCGAGTTTGTCACACGTATCACACACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-1266s1c1
Sequence:CCGGGTTTCATACCAAGGAGGCAAACTCGAGTTTGCCTCCTTGGTATGAAACTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167726    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-834s1c1
Sequence:CCGGGAAATGCAAATGAATACCGAACTCGAGTTCGGTATTCATTTGCATTTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-1146s1c1
Sequence:CCGGGAGGAACAGTTGGTTATAGAACTCGAGTTCTATAACCAACTGTTCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182484
BAGE5 MISSION shRNA shRNA Plasmid DNA
B melanoma antigen family, member 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000172796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-1434s1c1
Sequence:CCGGGCTGGAAACATCATGCCAACACTCGAGTGTTGGCATGATGTTTCCAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168639    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-757s1c1
Sequence:CCGGGTGTGTGATACGTGTGACAAACTCGAGTTTGTCACACGTATCACACACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000168727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-1266s1c1
Sequence:CCGGGTTTCATACCAAGGAGGCAAACTCGAGTTTGCCTCCTTGGTATGAAACTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167726    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-834s1c1
Sequence:CCGGGAAATGCAAATGAATACCGAACTCGAGTTCGGTATTCATTTGCATTTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-1146s1c1
Sequence:CCGGGAGGAACAGTTGGTTATAGAACTCGAGTTCTATAACCAACTGTTCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182484
BAGE5 MISSION shRNA Lentiviral Transduction Particles
B melanoma antigen family, member 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000172796    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-1434s1c1
Sequence:CCGGGCTGGAAACATCATGCCAACACTCGAGTGTTGGCATGATGTTTCCAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168639    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-757s1c1
Sequence:CCGGGTGTGTGATACGTGTGACAAACTCGAGTTTGTCACACGTATCACACACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000168727    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-1266s1c1
Sequence:CCGGGTTTCATACCAAGGAGGCAAACTCGAGTTTGCCTCCTTGGTATGAAACTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167726    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-834s1c1
Sequence:CCGGGAAATGCAAATGAATACCGAACTCGAGTTCGGTATTCATTTGCATTTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167620    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_182484.1-1146s1c1
Sequence:CCGGGAGGAACAGTTGGTTATAGAACTCGAGTTCTATAACCAACTGTTCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)