EMAIL THIS PAGE TO A FRIEND

BAGE

B melanoma antigen

34 Gene Product Result for
Synonyms: BAGE1 CT2.1
Species: Human BAGE(574)
UniProtKB ID: Q13072, A4IF47
Gene ID:
Human(574) Summary: This gene encodes a tumor antigen recognized by autologous cytolytic lymphocytes (CTL). [provided by RefSeq, Jul 2008]
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001187 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001187 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001187 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001187 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001187 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201137 predicted 710
2 SASI_Hs01_00201138 predicted 706
3 SASI_Hs01_00201139 predicted 708
4 SASI_Hs01_00201140 predicted 769
5 SASI_Hs01_00201141 predicted 701
6 SASI_Hs02_00331324 predicted 692
7 SASI_Hs01_00201143 predicted 695
8 SASI_Hs01_00201145 predicted 762
9 SASI_Hs01_00201146 predicted 714
10 SASI_Hs02_00331325 predicted 695
11 SASI_Hs01_00201142 predicted 744
12 SASI_Hs01_00201144 predicted 736
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001187
BAGE MISSION shRNA Bacterial Glycerol Stock
B melanoma antigen
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000173111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-466s1c1
Sequence:CCGGCGAGATTACAGCGATGTGCATCTCGAGATGCACATCGCTGTAATCTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-767s1c1
Sequence:CCGGGAGGGATCATTGCCAGAGATTCTCGAGAATCTCTGGCAATGATCCCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-637s1c1
Sequence:CCGGGATGTAAGTTTACTACGCATACTCGAGTATGCGTAGTAAACTTACATCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-713s1c1
Sequence:CCGGCTGAGTGTTATTCTACTTGTACTCGAGTACAAGTAGAATAACACTCAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-805s21c1
Sequence:CCGGTATCAACGGTTTCATTGAAATCTCGAGATTTCAATGAAACCGTTGATATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-626s21c1
Sequence:CCGGAGCTCCTGAAAGATGTAAGTTCTCGAGAACTTACATCTTTCAGGAGCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-671s21c1
Sequence:CCGGCAACCAATGTATTTACTGAAACTCGAGTTTCAGTAAATACATTGGTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-701s21c1
Sequence:CCGGGTTGTAAATTCCCTGAGTGTTCTCGAGAACACTCAGGGAATTTACAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001187
BAGE MISSION shRNA shRNA Plasmid DNA
B melanoma antigen
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000173111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-466s1c1
Sequence:CCGGCGAGATTACAGCGATGTGCATCTCGAGATGCACATCGCTGTAATCTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000172943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-767s1c1
Sequence:CCGGGAGGGATCATTGCCAGAGATTCTCGAGAATCTCTGGCAATGATCCCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-637s1c1
Sequence:CCGGGATGTAAGTTTACTACGCATACTCGAGTATGCGTAGTAAACTTACATCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000167124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-713s1c1
Sequence:CCGGCTGAGTGTTATTCTACTTGTACTCGAGTACAAGTAGAATAACACTCAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-805s21c1
Sequence:CCGGTATCAACGGTTTCATTGAAATCTCGAGATTTCAATGAAACCGTTGATATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-626s21c1
Sequence:CCGGAGCTCCTGAAAGATGTAAGTTCTCGAGAACTTACATCTTTCAGGAGCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-671s21c1
Sequence:CCGGCAACCAATGTATTTACTGAAACTCGAGTTTCAGTAAATACATTGGTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000371412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-701s21c1
Sequence:CCGGGTTGTAAATTCCCTGAGTGTTCTCGAGAACACTCAGGGAATTTACAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001187
BAGE MISSION shRNA Lentiviral Transduction Particles
B melanoma antigen
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000173111    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-466s1c1
Sequence:CCGGCGAGATTACAGCGATGTGCATCTCGAGATGCACATCGCTGTAATCTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000172943    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-767s1c1
Sequence:CCGGGAGGGATCATTGCCAGAGATTCTCGAGAATCTCTGGCAATGATCCCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167809    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-637s1c1
Sequence:CCGGGATGTAAGTTTACTACGCATACTCGAGTATGCGTAGTAAACTTACATCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000167124    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001187.1-713s1c1
Sequence:CCGGCTGAGTGTTATTCTACTTGTACTCGAGTACAAGTAGAATAACACTCAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371410    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-805s21c1
Sequence:CCGGTATCAACGGTTTCATTGAAATCTCGAGATTTCAATGAAACCGTTGATATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371359    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-626s21c1
Sequence:CCGGAGCTCCTGAAAGATGTAAGTTCTCGAGAACTTACATCTTTCAGGAGCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371358    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-671s21c1
Sequence:CCGGCAACCAATGTATTTACTGAAACTCGAGTTTCAGTAAATACATTGGTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000371412    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001187.1-701s21c1
Sequence:CCGGGTTGTAAATTCCCTGAGTGTTCTCGAGAACACTCAGGGAATTTACAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)