EMAIL THIS PAGE TO A FRIEND

BAHCC1

BAH domain and coiled-coil containing 1

Synonyms: BAHD2
UniProtKB ID: Q9P281, Q5U629
Gene ID:
Mouse(268515) BAH domain and coiled-coil containing 1
Rat(360674) BAH domain and coiled-coil containing 1
Zebrafish(794333) BAH domain and coiled-coil containing 1
dog(483361) BAH domain and coiled-coil containing 1
domestic cat(101097438) BAH domain and coiled-coil containing 1
Horse(100056038) BAH domain and coiled-coil containing 1
cow(786025) BAH domain and coiled-coil containing 1
chicken(776014) BAH domain and coiled-coil containing 1
naked mole-rat(101702139) BAH domain and coiled-coil containing 1
domestic guinea pig(100731264) BAH domain and coiled-coil containing 1
sheep(101109374) BAH domain and coiled-coil containing 1
104 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001080519 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001080519 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001080519 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001080519 Rosetta Predictions human pricing
XM_927254 Rosetta Predictions human pricing
XM_001081783 Rosetta Predictions rat pricing
XM_340947 Rosetta Predictions rat pricing
NM_198423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001080519 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00315627 predicted 4530
2 SASI_Hs02_00315628 predicted 5933
3 SASI_Hs02_00315629 predicted 1388
4 SASI_Hs02_00315630 predicted 6188
5 SASI_Hs02_00315631 predicted 1607
6 SASI_Hs02_00315632 predicted 1385
7 SASI_Hs02_00315633 predicted 6151
8 SASI_Hs02_00315634 predicted 3891
9 SASI_Hs02_00315635 predicted 5854
10 SASI_Hs02_00315636 predicted 6182
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_927254 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00269673 predicted 4166
2 SASI_Hs01_00269674 predicted 5558
3 SASI_Hs01_00269675 predicted 927
4 SASI_Hs01_00269676 predicted 5819
5 SASI_Hs01_00269677 predicted 1149
6 SASI_Hs01_00269678 predicted 924
7 SASI_Hs01_00269679 predicted 5778
8 SASI_Hs01_00269680 predicted 3519
9 SASI_Hs01_00269681 predicted 5488
10 SASI_Hs01_00269682 predicted 5565
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081783 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00373462 predicted 1225
2 SASI_Rn02_00373463 predicted 7742
3 SASI_Rn02_00373464 predicted 7369
4 SASI_Rn02_00373465 predicted 6000
5 SASI_Rn02_00373466 predicted 5849
6 SASI_Rn02_00373467 predicted 7352
7 SASI_Rn02_00373468 predicted 2009
8 SASI_Rn02_00373469 predicted 3974
9 SASI_Rn02_00373470 predicted 4049
10 SASI_Rn02_00373471 predicted 6142
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_340947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00154337 predicted 894
2 SASI_Rn01_00154338 predicted 832
3 SASI_Rn01_00154339 predicted 6661
4 SASI_Rn01_00154340 predicted 6364
5 SASI_Rn01_00154341 predicted 396
6 SASI_Rn01_00154342 predicted 1942
7 SASI_Rn01_00154343 predicted 2342
8 SASI_Rn01_00154344 predicted 4842
9 SASI_Rn01_00154345 predicted 6342
10 SASI_Rn01_00154346 predicted 1677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077925 predicted 6346
2 SASI_Mm01_00077927 predicted 6054
3 SASI_Mm02_00350986 predicted 2270
4 SASI_Mm02_00350987 predicted 1602
5 SASI_Mm01_00077930 predicted 5568
6 SASI_Mm01_00077931 predicted 6200
7 SASI_Mm02_00350988 predicted 4467
8 SASI_Mm01_00077932 predicted 6946
9 SASI_Mm02_00350989 predicted 2391
10 SASI_Mm02_00350990 predicted 4395
11 SASI_Mm01_00077926 predicted 2142
12 SASI_Mm01_00077928 predicted 1898
13 SASI_Mm01_00077929 predicted 306
14 SASI_Mm01_00077933 predicted 1930
15 SASI_Mm01_00077934 predicted 2938
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198423
BAHCC1 MISSION shRNA Bacterial Glycerol Stock
BAH domain and coiled-coil containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-651s1c1
Sequence:CCGGCGCATCCAGAAGAAGCTATCTCTCGAGAGATAGCTTCTTCTGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-1933s1c1
Sequence:CCGGCGGACTTCAAGATCCAGTGTACTCGAGTACACTGGATCTTGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-4589s1c1
Sequence:CCGGCGTATCTCTTACCTCTGTTTACTCGAGTAAACAGAGGTAAGAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-446s1c1
Sequence:CCGGGAAGCGAAGCAAACTGGGAAACTCGAGTTTCCCAGTTTGCTTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.3-2547s1c1
Sequence:CCGGGGCCCGATACAGCCTACAATACTCGAGTATTGTAGGCTGTATCGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198423.3-6355s21c1
Sequence:CCGGTCAGAAGTCCCGGTGTCTATACTCGAGTATAGACACCGGGACTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198423.3-1023s21c1
Sequence:CCGGACCGCTTCCTCATGGGTAAAGCTCGAGCTTTACCCATGAGGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198423.3-8969s21c1
Sequence:CCGGGAAATTACACTGCGGTTTATTCTCGAGAATAAACCGCAGTGTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198423.3-8034s21c1
Sequence:CCGGACATGGTGGTGAAGGTCAAATCTCGAGATTTGACCTTCACCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198423
BAHCC1 MISSION shRNA shRNA Plasmid DNA
BAH domain and coiled-coil containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-651s1c1
Sequence:CCGGCGCATCCAGAAGAAGCTATCTCTCGAGAGATAGCTTCTTCTGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-1933s1c1
Sequence:CCGGCGGACTTCAAGATCCAGTGTACTCGAGTACACTGGATCTTGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-4589s1c1
Sequence:CCGGCGTATCTCTTACCTCTGTTTACTCGAGTAAACAGAGGTAAGAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-446s1c1
Sequence:CCGGGAAGCGAAGCAAACTGGGAAACTCGAGTTTCCCAGTTTGCTTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.3-2547s1c1
Sequence:CCGGGGCCCGATACAGCCTACAATACTCGAGTATTGTAGGCTGTATCGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198423.3-6355s21c1
Sequence:CCGGTCAGAAGTCCCGGTGTCTATACTCGAGTATAGACACCGGGACTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198423.3-1023s21c1
Sequence:CCGGACCGCTTCCTCATGGGTAAAGCTCGAGCTTTACCCATGAGGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198423.3-8969s21c1
Sequence:CCGGGAAATTACACTGCGGTTTATTCTCGAGAATAAACCGCAGTGTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198423.3-8034s21c1
Sequence:CCGGACATGGTGGTGAAGGTCAAATCTCGAGATTTGACCTTCACCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198423
BAHCC1 MISSION shRNA Lentiviral Transduction Particles
BAH domain and coiled-coil containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182042    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-651s1c1
Sequence:CCGGCGCATCCAGAAGAAGCTATCTCTCGAGAGATAGCTTCTTCTGGATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181431    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-1933s1c1
Sequence:CCGGCGGACTTCAAGATCCAGTGTACTCGAGTACACTGGATCTTGAAGTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177458    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-4589s1c1
Sequence:CCGGCGTATCTCTTACCTCTGTTTACTCGAGTAAACAGAGGTAAGAGATACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181541    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.2-446s1c1
Sequence:CCGGGAAGCGAAGCAAACTGGGAAACTCGAGTTTCCCAGTTTGCTTCGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198423.3-2547s1c1
Sequence:CCGGGGCCCGATACAGCCTACAATACTCGAGTATTGTAGGCTGTATCGGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198423.3-6355s21c1
Sequence:CCGGTCAGAAGTCCCGGTGTCTATACTCGAGTATAGACACCGGGACTTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198423.3-1023s21c1
Sequence:CCGGACCGCTTCCTCATGGGTAAAGCTCGAGCTTTACCCATGAGGAAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198423.3-8969s21c1
Sequence:CCGGGAAATTACACTGCGGTTTATTCTCGAGAATAAACCGCAGTGTAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198423.3-8034s21c1
Sequence:CCGGACATGGTGGTGAAGGTCAAATCTCGAGATTTGACCTTCACCACCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001080519
BAHCC1 MISSION shRNA Bacterial Glycerol Stock
BAH domain and coiled-coil containing 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080519.2-7926s21c1
Sequence:CCGGAGGGCGCATCTGAGCAAATATCTCGAGATATTTGCTCAGATGCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-1896s21c1
Sequence:GTACCGGCATGAAGAACCTGCTCAAATACTCGAGTATTTGAGCAGGTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080519.2-8714s21c1
Sequence:CCGGATTGTATCTGCTGAATCATATCTCGAGATATGATTCAGCAGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-6188s21c1
Sequence:CCGGGCAAAGACAAAGCTGGTAAAGCTCGAGCTTTACCAGCTTTGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-5705s21c1
Sequence:CCGGTGCAGCCACCCGACATCTATACTCGAGTATAGATGTCGGGTGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-6427s21c1
Sequence:CCGGAGCGTGGCCACACCCATATTTCTCGAGAAATATGGGTGTGGCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000371000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-5935s21c1
Sequence:CCGGGACTCAGTAGTGGTGGAATTTCTCGAGAAATTCCACCACTACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001080519
BAHCC1 MISSION shRNA shRNA Plasmid DNA
BAH domain and coiled-coil containing 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080519.2-7926s21c1
Sequence:CCGGAGGGCGCATCTGAGCAAATATCTCGAGATATTTGCTCAGATGCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-1896s21c1
Sequence:GTACCGGCATGAAGAACCTGCTCAAATACTCGAGTATTTGAGCAGGTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080519.2-8714s21c1
Sequence:CCGGATTGTATCTGCTGAATCATATCTCGAGATATGATTCAGCAGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-6188s21c1
Sequence:CCGGGCAAAGACAAAGCTGGTAAAGCTCGAGCTTTACCAGCTTTGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-5705s21c1
Sequence:CCGGTGCAGCCACCCGACATCTATACTCGAGTATAGATGTCGGGTGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-6427s21c1
Sequence:CCGGAGCGTGGCCACACCCATATTTCTCGAGAAATATGGGTGTGGCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000371000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-5935s21c1
Sequence:CCGGGACTCAGTAGTGGTGGAATTTCTCGAGAAATTCCACCACTACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001080519
BAHCC1 MISSION shRNA Lentiviral Transduction Particles
BAH domain and coiled-coil containing 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377646    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080519.2-7926s21c1
Sequence:CCGGAGGGCGCATCTGAGCAAATATCTCGAGATATTTGCTCAGATGCGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-1896s21c1
Sequence:GTACCGGCATGAAGAACCTGCTCAAATACTCGAGTATTTGAGCAGGTTCTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001080519.2-8714s21c1
Sequence:CCGGATTGTATCTGCTGAATCATATCTCGAGATATGATTCAGCAGATACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-6188s21c1
Sequence:CCGGGCAAAGACAAAGCTGGTAAAGCTCGAGCTTTACCAGCTTTGTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-5705s21c1
Sequence:CCGGTGCAGCCACCCGACATCTATACTCGAGTATAGATGTCGGGTGGCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-6427s21c1
Sequence:CCGGAGCGTGGCCACACCCATATTTCTCGAGAAATATGGGTGTGGCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000371000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001080519.2-5935s21c1
Sequence:CCGGGACTCAGTAGTGGTGGAATTTCTCGAGAAATTCCACCACTACTGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks