EMAIL THIS PAGE TO A FRIEND

BAHD1

bromo adjacent homology domain containing 1

187 Gene Product Result for
UniProtKB ID: Q8TBE0, Q8NDF7, Q9Y2F4
Gene ID:
Mouse(228536) bromo adjacent homology domain containing 1
Rat(362194) bromo adjacent homology domain containing 1
sheep(101114113) bromo adjacent homology domain containing 1
Domestic Rabbit(100357253) bromo adjacent homology domain containing 1
domestic guinea pig(100715258) bromo adjacent homology domain containing 1
naked mole-rat(101711744) bromo adjacent homology domain containing 1
chicken(423010) bromo adjacent homology domain containing 1
domestic cat(101089697) bromo adjacent homology domain containing 1
cow(617684) bromo adjacent homology domain containing 1
Horse(100071395) bromo adjacent homology domain containing 1
dog(487495) bromo adjacent homology domain containing 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014952 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001045523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001045523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001045523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014952 Rosetta Predictions human pricing
XM_001080776 Rosetta Predictions rat pricing
XM_347035 Rosetta Predictions rat pricing
NM_001045523 Rosetta Predictions mouse pricing
XM_130491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193025 predicted 1867
2 SASI_Hs01_00193026 predicted 1980
3 SASI_Hs01_00193027 predicted 1991
4 SASI_Hs01_00193028 predicted 1315
5 SASI_Hs01_00193029 predicted 2084
6 SASI_Hs01_00193030 predicted 1981
7 SASI_Hs01_00193031 predicted 2172
8 SASI_Hs02_00346631 predicted 1858
9 SASI_Hs01_00193032 predicted 2508
10 SASI_Hs01_00193033 predicted 1996
11 SASI_Hs01_00193034 predicted 808
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080776 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00369312 predicted 688
2 SASI_Rn02_00369313 predicted 1979
3 SASI_Rn02_00369314 predicted 2173
4 SASI_Rn02_00369315 predicted 673
5 SASI_Rn02_00369316 predicted 1971
6 SASI_Rn02_00369317 predicted 2185
7 SASI_Rn02_00369318 predicted 221
8 SASI_Rn02_00369319 predicted 1694
9 SASI_Rn02_00369320 predicted 2158
10 SASI_Rn02_00369321 predicted 236
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347035 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399474 predicted 1036
2 SASI_Rn02_00399475 predicted 2320
3 SASI_Rn02_00399476 predicted 2513
4 SASI_Rn02_00399477 predicted 1016
5 SASI_Rn02_00399478 predicted 2312
6 SASI_Rn02_00399479 predicted 2527
7 SASI_Rn02_00399480 predicted 562
8 SASI_Rn02_00399481 predicted 2036
9 SASI_Rn02_00399482 predicted 2508
10 SASI_Rn02_00399483 predicted 581
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291584 predicted 2059
2 SASI_Mm02_00291585 predicted 2253
3 SASI_Mm02_00291586 predicted 2045
4 SASI_Mm02_00291587 predicted 753
5 SASI_Mm02_00291588 predicted 2255
6 SASI_Mm02_00291589 predicted 528
7 SASI_Mm02_00291590 predicted 1929
8 SASI_Mm02_00291591 predicted 762
9 SASI_Mm02_00291592 predicted 2059
10 SASI_Mm02_00291593 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_130491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00273250 predicted 1991
2 SASI_Mm01_00273251 predicted 1146
3 SASI_Mm01_00273252 predicted 2886
4 SASI_Mm01_00273253 predicted 2183
5 SASI_Mm01_00273254 predicted 1389
6 SASI_Mm01_00273255 predicted 2857
7 SASI_Mm01_00273256 predicted 1972
8 SASI_Mm01_00273257 predicted 1392
9 SASI_Mm01_00273258 predicted 2186
10 SASI_Mm01_00273259 predicted 2097
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014952
BAHD1 MISSION shRNA Bacterial Glycerol Stock
bromo adjacent homology domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-2125s21c1
Sequence:CCGGCCTTGCAGAATGAAGTGTTTGCTCGAGCAAACACTTCATTCTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-2058s21c1
Sequence:CCGGATGAGCCTCCTGTGGTATTACCTCGAGGTAATACCACAGGAGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-2179s21c1
Sequence:CCGGGCATTGAGGAGAAGTGCTATGCTCGAGCATAGCACTTCTCCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-1688s21c1
Sequence:CCGGCAAACCTCCCAGCGGTTCTAACTCGAGTTAGAACCGCTGGGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014952.2-3312s1c1
Sequence:CCGGCCCACCTGAAATCAAACCAAACTCGAGTTTGGTTTGATTTCAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014952.2-3124s1c1
Sequence:CCGGCCCAGAAAGTTAACTGATGATCTCGAGATCATCAGTTAACTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014952.2-437s1c1
Sequence:CCGGCAATGCTGAAGCTCTCAATAACTCGAGTTATTGAGAGCTTCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014952.2-821s1c1
Sequence:CCGGCAAGGTCAATGGCAAGAACTACTCGAGTAGTTCTTGCCATTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014952.2-4301s1c1
Sequence:CCGGGCTGGTAGAATTTCAATGGAACTCGAGTTCCATTGAAATTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014952
BAHD1 MISSION shRNA shRNA Plasmid DNA
bromo adjacent homology domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-2125s21c1
Sequence:CCGGCCTTGCAGAATGAAGTGTTTGCTCGAGCAAACACTTCATTCTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-2058s21c1
Sequence:CCGGATGAGCCTCCTGTGGTATTACCTCGAGGTAATACCACAGGAGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-2179s21c1
Sequence:CCGGGCATTGAGGAGAAGTGCTATGCTCGAGCATAGCACTTCTCCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-1688s21c1
Sequence:CCGGCAAACCTCCCAGCGGTTCTAACTCGAGTTAGAACCGCTGGGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014952.2-3312s1c1
Sequence:CCGGCCCACCTGAAATCAAACCAAACTCGAGTTTGGTTTGATTTCAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014952.2-3124s1c1
Sequence:CCGGCCCAGAAAGTTAACTGATGATCTCGAGATCATCAGTTAACTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014952.2-437s1c1
Sequence:CCGGCAATGCTGAAGCTCTCAATAACTCGAGTTATTGAGAGCTTCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014952.2-821s1c1
Sequence:CCGGCAAGGTCAATGGCAAGAACTACTCGAGTAGTTCTTGCCATTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014952.2-4301s1c1
Sequence:CCGGGCTGGTAGAATTTCAATGGAACTCGAGTTCCATTGAAATTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014952
BAHD1 MISSION shRNA Lentiviral Transduction Particles
bromo adjacent homology domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436527    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-2125s21c1
Sequence:CCGGCCTTGCAGAATGAAGTGTTTGCTCGAGCAAACACTTCATTCTGCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-2058s21c1
Sequence:CCGGATGAGCCTCCTGTGGTATTACCTCGAGGTAATACCACAGGAGGCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-2179s21c1
Sequence:CCGGGCATTGAGGAGAAGTGCTATGCTCGAGCATAGCACTTCTCCTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014952.3-1688s21c1
Sequence:CCGGCAAACCTCCCAGCGGTTCTAACTCGAGTTAGAACCGCTGGGAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130595    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014952.2-3312s1c1
Sequence:CCGGCCCACCTGAAATCAAACCAAACTCGAGTTTGGTTTGATTTCAGGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129644    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014952.2-3124s1c1
Sequence:CCGGCCCAGAAAGTTAACTGATGATCTCGAGATCATCAGTTAACTTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014952.2-437s1c1
Sequence:CCGGCAATGCTGAAGCTCTCAATAACTCGAGTTATTGAGAGCTTCAGCATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127907    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014952.2-821s1c1
Sequence:CCGGCAAGGTCAATGGCAAGAACTACTCGAGTAGTTCTTGCCATTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129912    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014952.2-4301s1c1
Sequence:CCGGGCTGGTAGAATTTCAATGGAACTCGAGTTCCATTGAAATTCTACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001045523
VALIDATED
BAHD1 MISSION shRNA Bacterial Glycerol Stock
bromo adjacent homology domain containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000239099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045523.1-3899s21c1
Sequence:CCGGTGAAGGCTTCACAGGTTAATTCTCGAGAATTAACCTGTGAAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045523.1-521s21c1
Sequence:CCGGCTTAATGCAGAGGCCCTTAATCTCGAGATTAAGGGCCTCTGCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045523.1-2049s21c1
Sequence:CCGGGAAAGACGTCTACACCTTATGCTCGAGCATAAGGTGTAGACGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000239096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045523.1-1577s21c1
Sequence:CCGGTCGCTCGGCCAATTGGAATTTCTCGAGAAATTCCAATTGGCCGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045523.1-754s21c1
Sequence:CCGGCAAGAGACTGGCTAGCTTAAACTCGAGTTTAAGCTAGCCAGTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001045523
VALIDATED
BAHD1 MISSION shRNA shRNA Plasmid DNA
bromo adjacent homology domain containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000239099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045523.1-3899s21c1
Sequence:CCGGTGAAGGCTTCACAGGTTAATTCTCGAGAATTAACCTGTGAAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045523.1-521s21c1
Sequence:CCGGCTTAATGCAGAGGCCCTTAATCTCGAGATTAAGGGCCTCTGCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045523.1-2049s21c1
Sequence:CCGGGAAAGACGTCTACACCTTATGCTCGAGCATAAGGTGTAGACGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000239096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045523.1-1577s21c1
Sequence:CCGGTCGCTCGGCCAATTGGAATTTCTCGAGAAATTCCAATTGGCCGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045523.1-754s21c1
Sequence:CCGGCAAGAGACTGGCTAGCTTAAACTCGAGTTTAAGCTAGCCAGTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001045523
VALIDATED
BAHD1 MISSION shRNA Lentiviral Transduction Particles
bromo adjacent homology domain containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000239099    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001045523.1-3899s21c1
Sequence:CCGGTGAAGGCTTCACAGGTTAATTCTCGAGAATTAACCTGTGAAGCCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045523.1-521s21c1
Sequence:CCGGCTTAATGCAGAGGCCCTTAATCTCGAGATTAAGGGCCTCTGCATTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001045523.1-2049s21c1
Sequence:CCGGGAAAGACGTCTACACCTTATGCTCGAGCATAAGGTGTAGACGTCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000239096    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045523.1-1577s21c1
Sequence:CCGGTCGCTCGGCCAATTGGAATTTCTCGAGAAATTCCAATTGGCCGAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001045523.1-754s21c1
Sequence:CCGGCAAGAGACTGGCTAGCTTAAACTCGAGTTTAAGCTAGCCAGTCTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks