EMAIL THIS PAGE TO A FRIEND

BAI1

brain-specific angiogenesis inhibitor 1

110 Gene Product Result for
Synonyms: GDAIF
UniProtKB ID: O14514
Gene ID:
Human(575) Summary: Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Mouse(107831) brain-specific angiogenesis inhibitor 1
Rat(362931) brain-specific angiogenesis inhibitor 1
chicken(100859755) brain-specific angiogenesis inhibitor 1
domestic cat(101086453) brain-specific angiogenesis inhibitor 1
cow(524070) brain-specific angiogenesis inhibitor 1
naked mole-rat(101715646) brain-specific angiogenesis inhibitor 1
domestic guinea pig(100724586) brain-specific angiogenesis inhibitor 1
sheep(101117595) brain-specific angiogenesis inhibitor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1283 Human BAI1 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174991 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174991 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174991 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001702 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001702 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001702 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001702 Rosetta Predictions human pricing
XM_001073400 Rosetta Predictions rat pricing
XM_343260 Rosetta Predictions rat pricing
NM_174991 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001702 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031449 predicted 2730
2 SASI_Hs01_00031450 predicted 2789
3 SASI_Hs01_00031451 predicted 1529
4 SASI_Hs01_00031452 predicted 3121
5 SASI_Hs01_00031453 predicted 2638
6 SASI_Hs01_00031454 predicted 3843
7 SASI_Hs01_00031455 predicted 2466
8 SASI_Hs01_00031456 predicted 2078
9 SASI_Hs01_00031458 predicted 3874
10 SASI_Hs02_00332373 predicted 2312
11 SASI_Hs01_00031457 predicted 2826
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073400 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00342694 predicted 1339
2 SASI_Rn02_00342695 predicted 1388
3 SASI_Rn02_00342696 predicted 227
4 SASI_Rn02_00342697 predicted 2259
5 SASI_Rn02_00342698 predicted 2559
6 SASI_Rn02_00342699 predicted 3854
7 SASI_Rn02_00342700 predicted 2398
8 SASI_Rn02_00342701 predicted 3849
9 SASI_Rn02_00342702 predicted 2163
10 SASI_Rn02_00342703 predicted 2443
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395533 predicted 2986
2 SASI_Rn02_00395534 predicted 3914
3 SASI_Rn02_00395535 predicted 3908
4 SASI_Rn02_00395536 predicted 2982
5 SASI_Rn02_00395537 predicted 2989
6 SASI_Rn02_00395538 predicted 230
7 SASI_Rn02_00395539 predicted 3843
8 SASI_Rn02_00395540 predicted 2990
9 SASI_Rn02_00395541 predicted 3701
10 SASI_Rn02_00395542 predicted 3749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174991 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00155993 predicted 2372
2 SASI_Mm01_00155994 predicted 3876
3 SASI_Mm01_00155995 predicted 2245
4 SASI_Mm01_00155996 predicted 1123
5 SASI_Mm01_00155997 predicted 3375
6 SASI_Mm01_00155998 predicted 4196
7 SASI_Mm01_00155999 predicted 3239
8 SASI_Mm01_00156000 predicted 1295
9 SASI_Mm01_00156001 predicted 1042
10 SASI_Mm01_00156002 predicted 3428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174991
BAI1 MISSION shRNA Bacterial Glycerol Stock
brain-specific angiogenesis inhibitor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000109530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174991.2-5216s1c1
Sequence:CCGGCCGCCATAGGACGGGCACAGACTCGAGTCTGTGCCCGTCCTATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-4830s1c1
Sequence:CCGGCGGTATGCAGAACTGGACTTTCTCGAGAAAGTCCAGTTCTGCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-2673s1c1
Sequence:CCGGCGCATGAAGGATTTGAGGGATCTCGAGATCCCTCAAATCCTTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-3348s1c1
Sequence:CCGGCGGTCCGTTATCCTCATCAATCTCGAGATTGATGAGGATAACGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000109532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-4491s1c1
Sequence:CCGGCCCAAATACAGCATCAACATTCTCGAGAATGTTGATGCTGTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174991
BAI1 MISSION shRNA shRNA Plasmid DNA
brain-specific angiogenesis inhibitor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000109530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174991.2-5216s1c1
Sequence:CCGGCCGCCATAGGACGGGCACAGACTCGAGTCTGTGCCCGTCCTATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-4830s1c1
Sequence:CCGGCGGTATGCAGAACTGGACTTTCTCGAGAAAGTCCAGTTCTGCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-2673s1c1
Sequence:CCGGCGCATGAAGGATTTGAGGGATCTCGAGATCCCTCAAATCCTTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-3348s1c1
Sequence:CCGGCGGTCCGTTATCCTCATCAATCTCGAGATTGATGAGGATAACGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000109532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-4491s1c1
Sequence:CCGGCCCAAATACAGCATCAACATTCTCGAGAATGTTGATGCTGTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174991
BAI1 MISSION shRNA Lentiviral Transduction Particles
brain-specific angiogenesis inhibitor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000109530    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_174991.2-5216s1c1
Sequence:CCGGCCGCCATAGGACGGGCACAGACTCGAGTCTGTGCCCGTCCTATGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109534    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-4830s1c1
Sequence:CCGGCGGTATGCAGAACTGGACTTTCTCGAGAAAGTCCAGTTCTGCATACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109533    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-2673s1c1
Sequence:CCGGCGCATGAAGGATTTGAGGGATCTCGAGATCCCTCAAATCCTTCATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109531    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-3348s1c1
Sequence:CCGGCGGTCCGTTATCCTCATCAATCTCGAGATTGATGAGGATAACGGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000109532    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174991.2-4491s1c1
Sequence:CCGGCCCAAATACAGCATCAACATTCTCGAGAATGTTGATGCTGTATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001702
BAI1 MISSION shRNA Bacterial Glycerol Stock
brain-specific angiogenesis inhibitor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-3120s1c1
Sequence:CCGGGCGTTCTGTCATCCTCATCAACTCGAGTTGATGAGGATGACAGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-417s1c1
Sequence:CCGGGCGCTACACTCTCTACATGAACTCGAGTTCATGTAGAGAGTGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-1536s1c1
Sequence:CCGGGCAAACCAAGTTCTGCAACATCTCGAGATGTTGCAGAACTTGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-2487s1c1
Sequence:CCGGCCTGGTTCTCAGCATCCATAACTCGAGTTATGGATGCTGAGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001702.1-5104s1c1
Sequence:CCGGAGAGCCAGATGCAGGACAGGACTCGAGTCCTGTCCTGCATCTGGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-2639s21c1
Sequence:CCGGCCGATGAAGCATCCGTGTTTGCTCGAGCAAACACGGATGCTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-2792s21c1
Sequence:CCGGTCGAGTTTGCCCACATGTATACTCGAGTATACATGTGGGCAAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-2488s21c1
Sequence:CCGGCTGGTTCTCAGCATCCATAAGCTCGAGCTTATGGATGCTGAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-3092s21c1
Sequence:CCGGTGTCCGTGTGGAGGTACATTCCTCGAGGAATGTACCTCCACACGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001702
BAI1 MISSION shRNA shRNA Plasmid DNA
brain-specific angiogenesis inhibitor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-3120s1c1
Sequence:CCGGGCGTTCTGTCATCCTCATCAACTCGAGTTGATGAGGATGACAGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-417s1c1
Sequence:CCGGGCGCTACACTCTCTACATGAACTCGAGTTCATGTAGAGAGTGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-1536s1c1
Sequence:CCGGGCAAACCAAGTTCTGCAACATCTCGAGATGTTGCAGAACTTGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-2487s1c1
Sequence:CCGGCCTGGTTCTCAGCATCCATAACTCGAGTTATGGATGCTGAGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001702.1-5104s1c1
Sequence:CCGGAGAGCCAGATGCAGGACAGGACTCGAGTCCTGTCCTGCATCTGGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-2639s21c1
Sequence:CCGGCCGATGAAGCATCCGTGTTTGCTCGAGCAAACACGGATGCTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-2792s21c1
Sequence:CCGGTCGAGTTTGCCCACATGTATACTCGAGTATACATGTGGGCAAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-2488s21c1
Sequence:CCGGCTGGTTCTCAGCATCCATAAGCTCGAGCTTATGGATGCTGAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-3092s21c1
Sequence:CCGGTGTCCGTGTGGAGGTACATTCCTCGAGGAATGTACCTCCACACGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001702
BAI1 MISSION shRNA Lentiviral Transduction Particles
brain-specific angiogenesis inhibitor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-3120s1c1
Sequence:CCGGGCGTTCTGTCATCCTCATCAACTCGAGTTGATGAGGATGACAGAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-417s1c1
Sequence:CCGGGCGCTACACTCTCTACATGAACTCGAGTTCATGTAGAGAGTGTAGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-1536s1c1
Sequence:CCGGGCAAACCAAGTTCTGCAACATCTCGAGATGTTGCAGAACTTGGTTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001702.1-2487s1c1
Sequence:CCGGCCTGGTTCTCAGCATCCATAACTCGAGTTATGGATGCTGAGAACCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011234    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001702.1-5104s1c1
Sequence:CCGGAGAGCCAGATGCAGGACAGGACTCGAGTCCTGTCCTGCATCTGGCTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378236    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-2639s21c1
Sequence:CCGGCCGATGAAGCATCCGTGTTTGCTCGAGCAAACACGGATGCTTCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-2792s21c1
Sequence:CCGGTCGAGTTTGCCCACATGTATACTCGAGTATACATGTGGGCAAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-2488s21c1
Sequence:CCGGCTGGTTCTCAGCATCCATAAGCTCGAGCTTATGGATGCTGAGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001702.2-3092s21c1
Sequence:CCGGTGTCCGTGTGGAGGTACATTCCTCGAGGAATGTACCTCCACACGGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks