EMAIL THIS PAGE TO A FRIEND

BAI2

brain-specific angiogenesis inhibitor 2

74 Gene Product Result for
UniProtKB ID: O60241, B9EGK9, Q5T6K0, Q8NGW8, Q96GZ9
Gene ID:
Human(576) Summary: BAI1, a p53-target gene, encodes brain-specific angiogenesis inhibitor, a seven-span transmembrane protein and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
Mouse(230775) brain-specific angiogenesis inhibitor 2
Rat(313058) brain-specific angiogenesis inhibitor 2
sheep(101106749) brain-specific angiogenesis inhibitor 2
domestic guinea pig(100728530) brain-specific angiogenesis inhibitor 2
naked mole-rat(101706855) brain-specific angiogenesis inhibitor 2
Zebrafish(556993) brain-specific angiogenesis inhibitor 2
cow(506672) brain-specific angiogenesis inhibitor 2
Horse(100070436) brain-specific angiogenesis inhibitor 2
domestic cat(101096248) brain-specific angiogenesis inhibitor 2
dog(487317) brain-specific angiogenesis inhibitor 2
chicken(426163) brain-specific angiogenesis inhibitor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173071 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_173071 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_173071 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001703 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001703 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001703 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001703 Rosetta Predictions human pricing
NM_001107914 Rosetta Predictions rat pricing
NM_173071 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001703 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165786 predicted 2359
2 SASI_Hs01_00165787 predicted 3635
3 SASI_Hs01_00165788 predicted 2273
4 SASI_Hs01_00165790 predicted 4742
5 SASI_Hs01_00165791 predicted 2858
6 SASI_Hs01_00165792 predicted 891
7 SASI_Hs01_00165793 predicted 3636
8 SASI_Hs01_00165794 predicted 3423
9 SASI_Hs02_00332374 predicted 358
10 SASI_Hs01_00165795 predicted 2112
11 SASI_Hs01_00165789 predicted 1237
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107914 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00233525 predicted 1530
2 SASI_Rn02_00233526 predicted 1937
3 SASI_Rn02_00233527 predicted 4551
4 SASI_Rn02_00233528 predicted 2122
5 SASI_Rn02_00233529 predicted 4002
6 SASI_Rn02_00233530 predicted 1990
7 SASI_Rn02_00233531 predicted 4469
8 SASI_Rn02_00233532 predicted 1904
9 SASI_Rn02_00233533 predicted 1925
10 SASI_Rn02_00233534 predicted 1722
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173071 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345146 predicted 1422
2 SASI_Mm01_00101636 predicted 2271
3 SASI_Mm01_00101637 predicted 1683
4 SASI_Mm02_00345147 predicted 1739
5 SASI_Mm01_00101639 predicted 4583
6 SASI_Mm01_00101640 predicted 4488
7 SASI_Mm01_00101641 predicted 2068
8 SASI_Mm01_00101642 predicted 2163
9 SASI_Mm01_00101644 predicted 2078
10 SASI_Mm02_00345148 predicted 3791
11 SASI_Mm01_00101638 predicted 783
12 SASI_Mm01_00101643 predicted 419
13 SASI_Mm01_00101645 predicted 802
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173071
BAI2 MISSION shRNA Bacterial Glycerol Stock
brain-specific angiogenesis inhibitor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-3516s21c1
Sequence:CCGGGGGATATGGCTCTCAACTGTGCTCGAGCACAGTTGAGAGCCATATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-584s21c1
Sequence:CCGGTGCACTTCGACAAGAACTTTGCTCGAGCAAAGTTCTTGTCGAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-942s21c1
Sequence:CCGGTGACCTGTTCACCACCGAGATCTCGAGATCTCGGTGGTGAACAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-425s21c1
Sequence:CCGGACCACTACCTGGTCAACTTTACTCGAGTAAAGTTGACCAGGTAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-1716s1c1
Sequence:CCGGCCAGCTTTGCTCGTTGCATATCTCGAGATATGCAACGAGCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-4435s1c1
Sequence:CCGGCCACGAACTCAACCAGAAGTTCTCGAGAACTTCTGGTTGAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-3262s1c1
Sequence:CCGGCGGGATTATCGTCTTCAACAACTCGAGTTGTTGAAGACGATAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-1189s1c1
Sequence:CCGGGCAGACTAAACTCTGCAGTATCTCGAGATACTGCAGAGTTTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-3153s1c1
Sequence:CCGGGCACCAAAGGATATGGTACATCTCGAGATGTACCATATCCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173071
BAI2 MISSION shRNA shRNA Plasmid DNA
brain-specific angiogenesis inhibitor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-3516s21c1
Sequence:CCGGGGGATATGGCTCTCAACTGTGCTCGAGCACAGTTGAGAGCCATATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-584s21c1
Sequence:CCGGTGCACTTCGACAAGAACTTTGCTCGAGCAAAGTTCTTGTCGAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-942s21c1
Sequence:CCGGTGACCTGTTCACCACCGAGATCTCGAGATCTCGGTGGTGAACAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-425s21c1
Sequence:CCGGACCACTACCTGGTCAACTTTACTCGAGTAAAGTTGACCAGGTAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-1716s1c1
Sequence:CCGGCCAGCTTTGCTCGTTGCATATCTCGAGATATGCAACGAGCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-4435s1c1
Sequence:CCGGCCACGAACTCAACCAGAAGTTCTCGAGAACTTCTGGTTGAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-3262s1c1
Sequence:CCGGCGGGATTATCGTCTTCAACAACTCGAGTTGTTGAAGACGATAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-1189s1c1
Sequence:CCGGGCAGACTAAACTCTGCAGTATCTCGAGATACTGCAGAGTTTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-3153s1c1
Sequence:CCGGGCACCAAAGGATATGGTACATCTCGAGATGTACCATATCCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173071
BAI2 MISSION shRNA Lentiviral Transduction Particles
brain-specific angiogenesis inhibitor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-3516s21c1
Sequence:CCGGGGGATATGGCTCTCAACTGTGCTCGAGCACAGTTGAGAGCCATATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415485    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-584s21c1
Sequence:CCGGTGCACTTCGACAAGAACTTTGCTCGAGCAAAGTTCTTGTCGAAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-942s21c1
Sequence:CCGGTGACCTGTTCACCACCGAGATCTCGAGATCTCGGTGGTGAACAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426967    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173071.2-425s21c1
Sequence:CCGGACCACTACCTGGTCAACTTTACTCGAGTAAAGTTGACCAGGTAGTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112155    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-1716s1c1
Sequence:CCGGCCAGCTTTGCTCGTTGCATATCTCGAGATATGCAACGAGCAAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112157    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-4435s1c1
Sequence:CCGGCCACGAACTCAACCAGAAGTTCTCGAGAACTTCTGGTTGAGTTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-3262s1c1
Sequence:CCGGCGGGATTATCGTCTTCAACAACTCGAGTTGTTGAAGACGATAATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-1189s1c1
Sequence:CCGGGCAGACTAAACTCTGCAGTATCTCGAGATACTGCAGAGTTTAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112156    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173071.1-3153s1c1
Sequence:CCGGGCACCAAAGGATATGGTACATCTCGAGATGTACCATATCCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001703
VALIDATED
BAI2 MISSION shRNA Bacterial Glycerol Stock
brain-specific angiogenesis inhibitor 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001703.1-4720s1c1
Sequence:CCGGGAGCGAAAGAAATTACGGTATCTCGAGATACCGTAATTTCTTTCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001703.1-5109s1c1
Sequence:CCGGGACTGCCCACTGCATATAAATCTCGAGATTTATATGCAGTGGGCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001703.1-2483s1c1
Sequence:CCGGGCTCTCTGATTGTCACAGATACTCGAGTATCTGTGACAATCAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001703.1-4573s1c1
Sequence:CCGGGCCTATGGATCTCTCCAGAATCTCGAGATTCTGGAGAGATCCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001703.1-2120s1c1
Sequence:CCGGGCTACCTGTATCTGTCACTTACTCGAGTAAGTGACAGATACAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001703
VALIDATED
BAI2 MISSION shRNA shRNA Plasmid DNA
brain-specific angiogenesis inhibitor 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001703.1-4720s1c1
Sequence:CCGGGAGCGAAAGAAATTACGGTATCTCGAGATACCGTAATTTCTTTCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001703.1-5109s1c1
Sequence:CCGGGACTGCCCACTGCATATAAATCTCGAGATTTATATGCAGTGGGCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001703.1-2483s1c1
Sequence:CCGGGCTCTCTGATTGTCACAGATACTCGAGTATCTGTGACAATCAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001703.1-4573s1c1
Sequence:CCGGGCCTATGGATCTCTCCAGAATCTCGAGATTCTGGAGAGATCCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001703.1-2120s1c1
Sequence:CCGGGCTACCTGTATCTGTCACTTACTCGAGTAAGTGACAGATACAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001703
VALIDATED
BAI2 MISSION shRNA Lentiviral Transduction Particles
brain-specific angiogenesis inhibitor 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001703.1-4720s1c1
Sequence:CCGGGAGCGAAAGAAATTACGGTATCTCGAGATACCGTAATTTCTTTCGCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008117    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001703.1-5109s1c1
Sequence:CCGGGACTGCCCACTGCATATAAATCTCGAGATTTATATGCAGTGGGCAGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001703.1-2483s1c1
Sequence:CCGGGCTCTCTGATTGTCACAGATACTCGAGTATCTGTGACAATCAGAGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_001703.1-4573s1c1
Sequence:CCGGGCCTATGGATCTCTCCAGAATCTCGAGATTCTGGAGAGATCCATAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001703.1-2120s1c1
Sequence:CCGGGCTACCTGTATCTGTCACTTACTCGAGTAAGTGACAGATACAGGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks