EMAIL THIS PAGE TO A FRIEND

BAI3

brain-specific angiogenesis inhibitor 3

122 Gene Product Result for
UniProtKB ID: O60242, O60297, Q2NKN6, Q5VY37, Q9BX54
Gene ID:
Human(577) Summary: This p53-target gene encodes a brain-specific angiogenesis inhibitor, a seven-span transmembrane protein, and is thought to be a member of the secretin receptor family. Brain-specific angiogenesis proteins BAI2 and BAI3 are similar to BAI1 in structure, have similar tissue specificities, and may also play a role in angiogenesis. [provided by RefSeq, Jul 2008]
Mouse(210933) brain-specific angiogenesis inhibitor 3
Rat(301309) brain-specific angiogenesis inhibitor 3
Zebrafish(566117) brain-specific angiogenesis inhibitor 3
chicken(421875) brain-specific angiogenesis inhibitor 3
cow(100337167) brain-specific angiogenesis inhibitor 3
Horse(100057127) brain-specific angiogenesis inhibitor 3
domestic cat(101084448) brain-specific angiogenesis inhibitor 3
dog(481870) brain-specific angiogenesis inhibitor 3
naked mole-rat(101726251) brain-specific angiogenesis inhibitor 3
domestic guinea pig(100725420) brain-specific angiogenesis inhibitor 3
sheep(101109454) brain-specific angiogenesis inhibitor 3
Domestic Rabbit(100348237) brain-specific angiogenesis inhibitor 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015963 Anti-BAI3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2900556 Anti-BAI3 antibody produced in rabbit affinity isolated antibody horse, monkey, rat, mouse, human
immunohistochemistry pricing
SAB2900714 Anti-BAI3 antibody produced in rabbit affinity isolated antibody Xenopus, bovine, rabbit, chicken, human, rat, mouse, monkey
immunohistochemistry pricing
SAB4502524 Anti-BAI3, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175642 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175642 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175642 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001704 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001704 Rosetta Predictions human pricing
NM_001106898 Rosetta Predictions rat pricing
NM_175642 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00332375 predicted 556
2 SASI_Hs01_00224666 predicted 3809
3 SASI_Hs02_00332376 predicted 2928
4 SASI_Hs01_00224669 predicted 3217
5 SASI_Hs01_00224670 predicted 3648
6 SASI_Hs01_00224672 predicted 4622
7 SASI_Hs01_00224673 predicted 1004
8 SASI_Hs02_00332377 predicted 3005
9 SASI_Hs02_00332378 predicted 448
10 SASI_Hs01_00224674 predicted 4879
11 SASI_Hs01_00224667 predicted 2024
12 SASI_Hs01_00224668 predicted 431
13 SASI_Hs01_00224671 predicted 2127
14 SASI_Hs01_00224675 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106898 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223496 predicted 3571
2 SASI_Rn02_00223497 predicted 609
3 SASI_Rn02_00223498 predicted 2978
4 SASI_Rn02_00223499 predicted 2836
5 SASI_Rn02_00223500 predicted 3703
6 SASI_Rn02_00223501 predicted 913
7 SASI_Rn02_00223502 predicted 211
8 SASI_Rn02_00223503 predicted 3673
9 SASI_Rn02_00223504 predicted 3992
10 SASI_Rn02_00223505 predicted 2010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175642 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097344 predicted 3624
2 SASI_Mm01_00097345 predicted 2589
3 SASI_Mm01_00097347 predicted 2251
4 SASI_Mm01_00097348 predicted 4316
5 SASI_Mm01_00097349 predicted 3025
6 SASI_Mm01_00097350 predicted 4034
7 SASI_Mm01_00097351 predicted 2889
8 SASI_Mm01_00097352 predicted 3761
9 SASI_Mm01_00097353 predicted 2271
10 SASI_Mm02_00346570 predicted 443
11 SASI_Mm01_00097346 predicted 1982
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175642
BAI3 MISSION shRNA Bacterial Glycerol Stock
brain-specific angiogenesis inhibitor 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000112160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-392s1c1
Sequence:CCGGGCCGGGTATTTCCAACTGATTCTCGAGAATCAGTTGGAAATACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-2697s1c1
Sequence:CCGGCGCAGCACTATGGAGGTATATCTCGAGATATACCTCCATAGTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-1555s1c1
Sequence:CCGGCTTATATCAATGGTGTGGAAACTCGAGTTTCCACACCATTGATATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-3370s1c1
Sequence:CCGGCGCTCCATATTGTTTCAGATACTCGAGTATCTGAAACAATATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-799s1c1
Sequence:CCGGCCTCGATCTGTCCATGAGAAACTCGAGTTTCTCATGGACAGATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175642.4-2792s21c1
Sequence:CCGGCCGATGCATCCCATACGAAATCTCGAGATTTCGTATGGGATGCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175642.4-2264s21c1
Sequence:CCGGACCCAGGCTCAATAGAGTTAACTCGAGTTAACTCTATTGAGCCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175642.4-2594s21c1
Sequence:CCGGGAAATTACACTGTCGTCAATTCTCGAGAATTGACGACAGTGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175642
BAI3 MISSION shRNA shRNA Plasmid DNA
brain-specific angiogenesis inhibitor 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000112160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-392s1c1
Sequence:CCGGGCCGGGTATTTCCAACTGATTCTCGAGAATCAGTTGGAAATACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-2697s1c1
Sequence:CCGGCGCAGCACTATGGAGGTATATCTCGAGATATACCTCCATAGTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-1555s1c1
Sequence:CCGGCTTATATCAATGGTGTGGAAACTCGAGTTTCCACACCATTGATATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-3370s1c1
Sequence:CCGGCGCTCCATATTGTTTCAGATACTCGAGTATCTGAAACAATATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-799s1c1
Sequence:CCGGCCTCGATCTGTCCATGAGAAACTCGAGTTTCTCATGGACAGATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175642.4-2792s21c1
Sequence:CCGGCCGATGCATCCCATACGAAATCTCGAGATTTCGTATGGGATGCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175642.4-2264s21c1
Sequence:CCGGACCCAGGCTCAATAGAGTTAACTCGAGTTAACTCTATTGAGCCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175642.4-2594s21c1
Sequence:CCGGGAAATTACACTGTCGTCAATTCTCGAGAATTGACGACAGTGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175642
BAI3 MISSION shRNA Lentiviral Transduction Particles
brain-specific angiogenesis inhibitor 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000112160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-392s1c1
Sequence:CCGGGCCGGGTATTTCCAACTGATTCTCGAGAATCAGTTGGAAATACCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-2697s1c1
Sequence:CCGGCGCAGCACTATGGAGGTATATCTCGAGATATACCTCCATAGTGCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112164    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-1555s1c1
Sequence:CCGGCTTATATCAATGGTGTGGAAACTCGAGTTTCCACACCATTGATATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-3370s1c1
Sequence:CCGGCGCTCCATATTGTTTCAGATACTCGAGTATCTGAAACAATATGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175642.2-799s1c1
Sequence:CCGGCCTCGATCTGTCCATGAGAAACTCGAGTTTCTCATGGACAGATCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175642.4-2792s21c1
Sequence:CCGGCCGATGCATCCCATACGAAATCTCGAGATTTCGTATGGGATGCATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175642.4-2264s21c1
Sequence:CCGGACCCAGGCTCAATAGAGTTAACTCGAGTTAACTCTATTGAGCCTGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175642.4-2594s21c1
Sequence:CCGGGAAATTACACTGTCGTCAATTCTCGAGAATTGACGACAGTGTAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001704
BAI3 MISSION shRNA Bacterial Glycerol Stock
brain-specific angiogenesis inhibitor 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001704.1-4882s1c1
Sequence:CCGGCCGCTTCATATGGTTTAGTTTCTCGAGAAACTAAACCATATGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-4470s1c1
Sequence:CCGGCCCGCATTACACCACAATCAACTCGAGTTGATTGTGGTGTAATGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-436s1c1
Sequence:CCGGCCAACTAATTTCCCAGGATTACTCGAGTAATCCTGGGAAATTAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-3808s1c1
Sequence:CCGGCCCATGAGTATGAATGAGCTTCTCGAGAAGCTCATTCATACTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-2731s1c1
Sequence:CCGGGCAGCATTATGGAGGTACATACTCGAGTATGTACCTCCATAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-2979s21c1
Sequence:CCGGCCGATGCATCCCATACGAAATCTCGAGATTTCGTATGGGATGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-841s21c1
Sequence:CCGGTCGAGTATTTCCAACTAATTTCTCGAGAAATTAGTTGGAAATACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-4790s21c1
Sequence:CCGGTTGGACAGATTTCGGGATATACTCGAGTATATCCCGAAATCTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-3654s21c1
Sequence:CCGGATAGCGGTTTGACGCTCAAATCTCGAGATTTGAGCGTCAAACCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001704
BAI3 MISSION shRNA shRNA Plasmid DNA
brain-specific angiogenesis inhibitor 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001704.1-4882s1c1
Sequence:CCGGCCGCTTCATATGGTTTAGTTTCTCGAGAAACTAAACCATATGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-4470s1c1
Sequence:CCGGCCCGCATTACACCACAATCAACTCGAGTTGATTGTGGTGTAATGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-436s1c1
Sequence:CCGGCCAACTAATTTCCCAGGATTACTCGAGTAATCCTGGGAAATTAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-3808s1c1
Sequence:CCGGCCCATGAGTATGAATGAGCTTCTCGAGAAGCTCATTCATACTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-2731s1c1
Sequence:CCGGGCAGCATTATGGAGGTACATACTCGAGTATGTACCTCCATAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-2979s21c1
Sequence:CCGGCCGATGCATCCCATACGAAATCTCGAGATTTCGTATGGGATGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-841s21c1
Sequence:CCGGTCGAGTATTTCCAACTAATTTCTCGAGAAATTAGTTGGAAATACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-4790s21c1
Sequence:CCGGTTGGACAGATTTCGGGATATACTCGAGTATATCCCGAAATCTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-3654s21c1
Sequence:CCGGATAGCGGTTTGACGCTCAAATCTCGAGATTTGAGCGTCAAACCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001704
BAI3 MISSION shRNA Lentiviral Transduction Particles
brain-specific angiogenesis inhibitor 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008122    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001704.1-4882s1c1
Sequence:CCGGCCGCTTCATATGGTTTAGTTTCTCGAGAAACTAAACCATATGAAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-4470s1c1
Sequence:CCGGCCCGCATTACACCACAATCAACTCGAGTTGATTGTGGTGTAATGCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008124    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-436s1c1
Sequence:CCGGCCAACTAATTTCCCAGGATTACTCGAGTAATCCTGGGAAATTAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-3808s1c1
Sequence:CCGGCCCATGAGTATGAATGAGCTTCTCGAGAAGCTCATTCATACTCATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008125    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001704.1-2731s1c1
Sequence:CCGGGCAGCATTATGGAGGTACATACTCGAGTATGTACCTCCATAATGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356780    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-2979s21c1
Sequence:CCGGCCGATGCATCCCATACGAAATCTCGAGATTTCGTATGGGATGCATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356716    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-841s21c1
Sequence:CCGGTCGAGTATTTCCAACTAATTTCTCGAGAAATTAGTTGGAAATACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-4790s21c1
Sequence:CCGGTTGGACAGATTTCGGGATATACTCGAGTATATCCCGAAATCTGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378134    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001704.2-3654s21c1
Sequence:CCGGATAGCGGTTTGACGCTCAAATCTCGAGATTTGAGCGTCAAACCGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks