EMAIL THIS PAGE TO A FRIEND

BAIAP2-AS1

BAIAP2 antisense RNA 1 (head to head)

38 Gene Product Result for
Species: Human BAIAP2-AS1(440465)
Gene ID:
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001004336 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004336 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004336 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004336 Rosetta Predictions human pricing
XR_017982 Rosetta Predictions human pricing
XR_040055 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004336 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197416 predicted 219
2 SASI_Hs01_00197417 predicted 622
3 SASI_Hs01_00197418 predicted 215
4 SASI_Hs01_00197419 predicted 623
5 SASI_Hs01_00197420 predicted 217
6 SASI_Hs01_00197421 predicted 424
7 SASI_Hs01_00197422 predicted 420
8 SASI_Hs01_00197423 predicted 401
9 SASI_Hs01_00197424 predicted 407
10 SASI_Hs01_00197425 predicted 459
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_017982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00495175 predicted 983
2 SASI_Hs02_00495176 predicted 987
3 SASI_Hs02_00495177 predicted 2518
4 SASI_Hs02_00495178 predicted 2502
5 SASI_Hs02_00495179 predicted 2924
6 SASI_Hs02_00495180 predicted 989
7 SASI_Hs02_00495181 predicted 2510
8 SASI_Hs02_00495182 predicted 2716
9 SASI_Hs02_00495183 predicted 2351
10 SASI_Hs02_00495184 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_040055 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00515510 predicted 980
2 SASI_Hs02_00515511 predicted 2514
3 SASI_Hs02_00515512 predicted 2912
4 SASI_Hs02_00515513 predicted 1095
5 SASI_Hs02_00515514 predicted 1364
6 SASI_Hs02_00515515 predicted 2507
7 SASI_Hs02_00515516 predicted 985
8 SASI_Hs02_00515517 predicted 1527
9 SASI_Hs02_00515518 predicted 2700
10 SASI_Hs02_00515519 predicted 2805
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004336
BAIAP2-AS1 MISSION shRNA Bacterial Glycerol Stock
BAIAP2 antisense RNA 1 (head to head)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-387s1c1
Sequence:CCGGCCGTTTCTTTGCTTCCTGGATCTCGAGATCCAGGAAGCAAAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-185s1c1
Sequence:CCGGCAGTAACCAGAAAGTTCCAGACTCGAGTCTGGAACTTTCTGGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-105s1c1
Sequence:CCGGCTTTGCCTTCTCTCCAAGAGACTCGAGTCTCTTGGAGAGAAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165230    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004336.1-1551s1c1
Sequence:CCGGGCAGTGGCTTACACCTGTAATCTCGAGATTACAGGTGTAAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-136s1c1
Sequence:CCGGCAATCAGAACTCCTCTTCCTTCTCGAGAAGGAAGAGGAGTTCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004336.1-837s1c1
Sequence:CCGGCCAGGCATAAAGTGACATAAACTCGAGTTTATGTCACTTTATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-180s1c1
Sequence:CCGGGTAATCAGTAACCAGAAAGTTCTCGAGAACTTTCTGGTTACTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004336.1-1512s1c1
Sequence:CCGGCCCTTGTCTTAGTATTAGAAACTCGAGTTTCTAATACTAAGACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-175s1c1
Sequence:CCGGCACTTGTAATCAGTAACCAGACTCGAGTCTGGTTACTGATTACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004336
BAIAP2-AS1 MISSION shRNA shRNA Plasmid DNA
BAIAP2 antisense RNA 1 (head to head)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-387s1c1
Sequence:CCGGCCGTTTCTTTGCTTCCTGGATCTCGAGATCCAGGAAGCAAAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-185s1c1
Sequence:CCGGCAGTAACCAGAAAGTTCCAGACTCGAGTCTGGAACTTTCTGGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-105s1c1
Sequence:CCGGCTTTGCCTTCTCTCCAAGAGACTCGAGTCTCTTGGAGAGAAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165230    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004336.1-1551s1c1
Sequence:CCGGGCAGTGGCTTACACCTGTAATCTCGAGATTACAGGTGTAAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-136s1c1
Sequence:CCGGCAATCAGAACTCCTCTTCCTTCTCGAGAAGGAAGAGGAGTTCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004336.1-837s1c1
Sequence:CCGGCCAGGCATAAAGTGACATAAACTCGAGTTTATGTCACTTTATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-180s1c1
Sequence:CCGGGTAATCAGTAACCAGAAAGTTCTCGAGAACTTTCTGGTTACTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004336.1-1512s1c1
Sequence:CCGGCCCTTGTCTTAGTATTAGAAACTCGAGTTTCTAATACTAAGACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-175s1c1
Sequence:CCGGCACTTGTAATCAGTAACCAGACTCGAGTCTGGTTACTGATTACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004336
BAIAP2-AS1 MISSION shRNA Lentiviral Transduction Particles
BAIAP2 antisense RNA 1 (head to head)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-387s1c1
Sequence:CCGGCCGTTTCTTTGCTTCCTGGATCTCGAGATCCAGGAAGCAAAGAAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164486    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-185s1c1
Sequence:CCGGCAGTAACCAGAAAGTTCCAGACTCGAGTCTGGAACTTTCTGGTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164731    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-105s1c1
Sequence:CCGGCTTTGCCTTCTCTCCAAGAGACTCGAGTCTCTTGGAGAGAAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165230    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004336.1-1551s1c1
Sequence:CCGGGCAGTGGCTTACACCTGTAATCTCGAGATTACAGGTGTAAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164370    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-136s1c1
Sequence:CCGGCAATCAGAACTCCTCTTCCTTCTCGAGAAGGAAGAGGAGTTCTGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161717    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004336.1-837s1c1
Sequence:CCGGCCAGGCATAAAGTGACATAAACTCGAGTTTATGTCACTTTATGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159692    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-180s1c1
Sequence:CCGGGTAATCAGTAACCAGAAAGTTCTCGAGAACTTTCTGGTTACTGATTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160624    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001004336.1-1512s1c1
Sequence:CCGGCCCTTGTCTTAGTATTAGAAACTCGAGTTTCTAATACTAAGACAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162132    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001004336.1-175s1c1
Sequence:CCGGCACTTGTAATCAGTAACCAGACTCGAGTCTGGTTACTGATTACAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks