EMAIL THIS PAGE TO A FRIEND

BAIAP2

BAI1-associated protein 2

140 Gene Product Result for
Synonyms: BAP2 FLAF3 IRSP53
Gene ID:
Human(10458) Summary: The protein encoded by this gene has been identified as a brain-specific angiogenesis inhibitor (BAI1)-binding protein. This adaptor protein links membrane bound G-proteins to cytoplasmic effector proteins. This protein functions as an insulin receptor tyrosine kinase substrate and suggests a role for insulin in the central nervous system. It also associates with a downstream effector of Rho small G proteins, which is associated with the formation of stress fibers and cytokinesis. This protein is involved in lamellipodia and filopodia formation in motile cells and may affect neuronal growth-cone guidance. This protein has also been identified as interacting with the dentatorubral-pallidoluysian atrophy gene, which is associated with an autosomal dominant neurodegenerative disease. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Jan 2009]
Mouse(108100) brain-specific angiogenesis inhibitor 1-associated protein 2
Rat(117542) BAI1-associated protein 2
sheep(101109895) BAI1-associated protein 2
domestic guinea pig(100734135) BAI1-associated protein 2
naked mole-rat(101697688) BAI1-associated protein 2
chicken(422077) BAI1-associated protein 2
domestic cat(101087366) BAI1-associated protein 2
dog(403473) BAI1-associated protein 2
cow(507837) BAI1-associated protein 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130862 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130862 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130862 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006340 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006340 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006340 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006340 Rosetta Predictions human pricing
NM_017450 Rosetta Predictions human pricing
NM_017451 Rosetta Predictions human pricing
NM_057196 Rosetta Predictions rat pricing
NM_001037754 Rosetta Predictions mouse pricing
NM_001037755 Rosetta Predictions mouse pricing
NM_130862 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006340 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210744 predicted 1144
2 SASI_Hs01_00210746 predicted 1212
3 SASI_Hs01_00210748 predicted 429
4 SASI_Hs01_00210749 predicted 216
5 SASI_Hs01_00210750 predicted 243
6 SASI_Hs01_00210751 predicted 1327
7 SASI_Hs01_00210752 predicted 1374
8 SASI_Hs01_00210743 predicted 358
9 SASI_Hs01_00210745 predicted 508
10 SASI_Hs01_00210747 predicted 359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235437 predicted 1147
2 SASI_Hs01_00235439 predicted 1211
3 SASI_Hs01_00235441 predicted 431
4 SASI_Hs01_00235442 predicted 216
5 SASI_Hs01_00235443 predicted 244
6 SASI_Hs01_00235444 predicted 1324
7 SASI_Hs01_00235445 predicted 1377
8 SASI_Hs01_00235436 predicted 359
9 SASI_Hs01_00235438 predicted 513
10 SASI_Hs01_00235440 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017451 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124063 predicted 1140
2 SASI_Hs01_00124065 predicted 1215
3 SASI_Hs01_00124067 predicted 431
4 SASI_Hs01_00124068 predicted 221
5 SASI_Hs01_00124069 predicted 241
6 SASI_Hs01_00124070 predicted 1326
7 SASI_Hs01_00124071 predicted 1380
8 SASI_Hs01_00124062 predicted 357
9 SASI_Hs01_00124064 predicted 509
10 SASI_Hs01_00124066 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00112781 predicted 1494
2 SASI_Rn01_00112782 predicted 391
3 SASI_Rn01_00112783 predicted 943
4 SASI_Rn01_00112784 predicted 1371
5 SASI_Rn01_00112785 predicted 1221
6 SASI_Rn01_00112786 predicted 695
7 SASI_Rn01_00112787 predicted 456
8 SASI_Rn01_00112788 predicted 1153
9 SASI_Rn01_00112790 predicted 473
10 SASI_Rn02_00267145 predicted 602
11 SASI_Rn01_00112789 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025889 predicted 616
2 SASI_Mm01_00025890 predicted 701
3 SASI_Mm02_00289413 predicted 1240
4 SASI_Mm01_00025891 predicted 1133
5 SASI_Mm01_00025892 predicted 546
6 SASI_Mm01_00025893 predicted 1258
7 SASI_Mm01_00025894 predicted 1147
8 SASI_Mm01_00025895 predicted 672
9 SASI_Mm01_00025896 predicted 601
10 SASI_Mm01_00025897 predicted 684
11 SASI_Mm01_00025898 predicted 641
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00096614 predicted 661
2 SASI_Mm01_00096615 predicted 740
3 SASI_Mm02_00289414 predicted 1409
4 SASI_Mm01_00096616 predicted 1302
5 SASI_Mm01_00096617 predicted 586
6 SASI_Mm01_00096618 predicted 1420
7 SASI_Mm01_00096619 predicted 1311
8 SASI_Mm01_00096620 predicted 710
9 SASI_Mm01_00096621 predicted 643
10 SASI_Mm01_00096622 predicted 729
11 SASI_Mm01_00096623 predicted 685
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130862 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338277 predicted 661
2 SASI_Mm02_00338278 predicted 742
3 SASI_Mm02_00338279 predicted 1405
4 SASI_Mm02_00338280 predicted 1298
5 SASI_Mm02_00338281 predicted 583
6 SASI_Mm02_00338282 predicted 1413
7 SASI_Mm02_00338283 predicted 1311
8 SASI_Mm01_00062240 predicted 716
9 SASI_Mm02_00338284 predicted 639
10 SASI_Mm02_00338285 predicted 723
11 SASI_Mm01_00062235 predicted 1558
12 SASI_Mm01_00062236 predicted 984
13 SASI_Mm01_00062237 predicted 527
14 SASI_Mm01_00062238 predicted 835
15 SASI_Mm01_00062239 predicted 451
16 SASI_Mm01_00062241 predicted 1224
17 SASI_Mm01_00062242 predicted 900
18 SASI_Mm01_00062243 predicted 465
19 SASI_Mm01_00062244 predicted 534
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130862
VALIDATED
BAIAP2 MISSION shRNA Bacterial Glycerol Stock
BAI1-associated protein 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-1420s21c1
Sequence:CCGGCGGAAGTGACAGATTGCATATCTCGAGATATGCAATCTGTCACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-595s21c1
Sequence:CCGGCATCGATGCCATCAGCAATAACTCGAGTTATTGCTGATGGCATCGATGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130862.4-2122s21c1
Sequence:CCGGCCGGTGTACGTACTGTTATTCCTCGAGGAATAACAGTACGTACACCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-1208s21c1
Sequence:CCGGGCAGCTGGCCTAGAACGTAATCTCGAGATTACGTTCTAGGCCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-831s21c1
Sequence:CCGGTGATGCAACAGATGGCCAATACTCGAGTATTGGCCATCTGTTGCATCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130862.1-1672s1c1
Sequence:CCGGGCCACAGACTTGGTTAGAGTACTCGAGTACTCTAACCAAGTCTGTGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-1411s1c1
Sequence:CCGGCGGAAGTGACAGATTGCATATCTCGAGATATGCAATCTGTCACTTCCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-246s1c1
Sequence:CCGGGCTATTTCGATGCTCTGGTAACTCGAGTTACCAGAGCATCGAAATAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-452s1c1
Sequence:CCGGCTGAAGAAATACCAAACGGAACTCGAGTTCCGTTTGGTATTTCTTCAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-247s1c1
Sequence:CCGGCTATTTCGATGCTCTGGTAAACTCGAGTTTACCAGAGCATCGAAATAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130862
VALIDATED
BAIAP2 MISSION shRNA shRNA Plasmid DNA
BAI1-associated protein 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-1420s21c1
Sequence:CCGGCGGAAGTGACAGATTGCATATCTCGAGATATGCAATCTGTCACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000311498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-595s21c1
Sequence:CCGGCATCGATGCCATCAGCAATAACTCGAGTTATTGCTGATGGCATCGATGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130862.4-2122s21c1
Sequence:CCGGCCGGTGTACGTACTGTTATTCCTCGAGGAATAACAGTACGTACACCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-1208s21c1
Sequence:CCGGGCAGCTGGCCTAGAACGTAATCTCGAGATTACGTTCTAGGCCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000306312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-831s21c1
Sequence:CCGGTGATGCAACAGATGGCCAATACTCGAGTATTGGCCATCTGTTGCATCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130862.1-1672s1c1
Sequence:CCGGGCCACAGACTTGGTTAGAGTACTCGAGTACTCTAACCAAGTCTGTGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-1411s1c1
Sequence:CCGGCGGAAGTGACAGATTGCATATCTCGAGATATGCAATCTGTCACTTCCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-246s1c1
Sequence:CCGGGCTATTTCGATGCTCTGGTAACTCGAGTTACCAGAGCATCGAAATAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-452s1c1
Sequence:CCGGCTGAAGAAATACCAAACGGAACTCGAGTTCCGTTTGGTATTTCTTCAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000079057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-247s1c1
Sequence:CCGGCTATTTCGATGCTCTGGTAAACTCGAGTTTACCAGAGCATCGAAATAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130862
VALIDATED
BAIAP2 MISSION shRNA Lentiviral Transduction Particles
BAI1-associated protein 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-1420s21c1
Sequence:CCGGCGGAAGTGACAGATTGCATATCTCGAGATATGCAATCTGTCACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000311498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-595s21c1
Sequence:CCGGCATCGATGCCATCAGCAATAACTCGAGTTATTGCTGATGGCATCGATGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306311    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_130862.4-2122s21c1
Sequence:CCGGCCGGTGTACGTACTGTTATTCCTCGAGGAATAACAGTACGTACACCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306254    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-1208s21c1
Sequence:CCGGGCAGCTGGCCTAGAACGTAATCTCGAGATTACGTTCTAGGCCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000306312    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_130862.4-831s21c1
Sequence:CCGGTGATGCAACAGATGGCCAATACTCGAGTATTGGCCATCTGTTGCATCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130862.1-1672s1c1
Sequence:CCGGGCCACAGACTTGGTTAGAGTACTCGAGTACTCTAACCAAGTCTGTGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-1411s1c1
Sequence:CCGGCGGAAGTGACAGATTGCATATCTCGAGATATGCAATCTGTCACTTCCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-246s1c1
Sequence:CCGGGCTATTTCGATGCTCTGGTAACTCGAGTTACCAGAGCATCGAAATAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-452s1c1
Sequence:CCGGCTGAAGAAATACCAAACGGAACTCGAGTTCCGTTTGGTATTTCTTCAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000079057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_130862.1-247s1c1
Sequence:CCGGCTATTTCGATGCTCTGGTAAACTCGAGTTTACCAGAGCATCGAAATAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006340
VALIDATED
BAIAP2 MISSION shRNA Bacterial Glycerol Stock
BAI1-associated protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006340.2-463s21c1
Sequence:CCGGGCGCTGAAGAAATACCAGACTCTCGAGAGTCTGGTATTTCTTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006340.2-891s21c1
Sequence:CCGGCAAGTCCAACCTGGTCATTTCCTCGAGGAAATGACCAGGTTGGACTTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006340.2-1356s21c1
Sequence:CCGGAGAGAGTGAGAAGACCAAGATCTCGAGATCTTGGTCTTCTCACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006340.2-558s21c1
Sequence:CCGGCAGCAAGAATCCTCAGAAGTACTCGAGTACTTCTGAGGATTCTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006340.2-1674s21c1
Sequence:CCGGCGCCTGACTAGAGTTAGAATCCTCGAGGATTCTAACTCTAGTCAGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006340.1-448s1c1
Sequence:CCGGGCGCTGAAGAAATACCAGACTCTCGAGAGTCTGGTATTTCTTCAGCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006340.1-316s1c1
Sequence:CCGGGTTCTCTTCCAGATGGCTGAACTCGAGTTCAGCCATCTGGAAGAGAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006340.1-1341s1c1
Sequence:CCGGAGAGAGTGAGAAGACCAAGATCTCGAGATCTTGGTCTTCTCACTCTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006340.1-543s1c1
Sequence:CCGGCAGCAAGAATCCTCAGAAGTACTCGAGTACTTCTGAGGATTCTTGCTGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006340.1-1615s1c1
Sequence:CCGGCGGTCCATGAGCAGCGCCGATCTCGAGATCGGCGCTGCTCATGGACCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006340
VALIDATED
BAIAP2 MISSION shRNA shRNA Plasmid DNA
BAI1-associated protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006340.2-463s21c1
Sequence:CCGGGCGCTGAAGAAATACCAGACTCTCGAGAGTCTGGTATTTCTTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006340.2-891s21c1
Sequence:CCGGCAAGTCCAACCTGGTCATTTCCTCGAGGAAATGACCAGGTTGGACTTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006340.2-1356s21c1
Sequence:CCGGAGAGAGTGAGAAGACCAAGATCTCGAGATCTTGGTCTTCTCACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000291325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006340.2-558s21c1
Sequence:CCGGCAGCAAGAATCCTCAGAAGTACTCGAGTACTTCTGAGGATTCTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000296966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006340.2-1674s21c1
Sequence:CCGGCGCCTGACTAGAGTTAGAATCCTCGAGGATTCTAACTCTAGTCAGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006340.1-448s1c1
Sequence:CCGGGCGCTGAAGAAATACCAGACTCTCGAGAGTCTGGTATTTCTTCAGCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006340.1-316s1c1
Sequence:CCGGGTTCTCTTCCAGATGGCTGAACTCGAGTTCAGCCATCTGGAAGAGAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006340.1-1341s1c1
Sequence:CCGGAGAGAGTGAGAAGACCAAGATCTCGAGATCTTGGTCTTCTCACTCTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006340.1-543s1c1
Sequence:CCGGCAGCAAGAATCCTCAGAAGTACTCGAGTACTTCTGAGGATTCTTGCTGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000060952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006340.1-1615s1c1
Sequence:CCGGCGGTCCATGAGCAGCGCCGATCTCGAGATCGGCGCTGCTCATGGACCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006340
VALIDATED
BAIAP2 MISSION shRNA Lentiviral Transduction Particles
BAI1-associated protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307663    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_006340.2-463s21c1
Sequence:CCGGGCGCTGAAGAAATACCAGACTCTCGAGAGTCTGGTATTTCTTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006340.2-891s21c1
Sequence:CCGGCAAGTCCAACCTGGTCATTTCCTCGAGGAAATGACCAGGTTGGACTTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006340.2-1356s21c1
Sequence:CCGGAGAGAGTGAGAAGACCAAGATCTCGAGATCTTGGTCTTCTCACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000291325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006340.2-558s21c1
Sequence:CCGGCAGCAAGAATCCTCAGAAGTACTCGAGTACTTCTGAGGATTCTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000296966    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006340.2-1674s21c1
Sequence:CCGGCGCCTGACTAGAGTTAGAATCCTCGAGGATTCTAACTCTAGTCAGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060948    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006340.1-448s1c1
Sequence:CCGGGCGCTGAAGAAATACCAGACTCTCGAGAGTCTGGTATTTCTTCAGCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006340.1-316s1c1
Sequence:CCGGGTTCTCTTCCAGATGGCTGAACTCGAGTTCAGCCATCTGGAAGAGAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006340.1-1341s1c1
Sequence:CCGGAGAGAGTGAGAAGACCAAGATCTCGAGATCTTGGTCTTCTCACTCTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006340.1-543s1c1
Sequence:CCGGCAGCAAGAATCCTCAGAAGTACTCGAGTACTTCTGAGGATTCTTGCTGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000060952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006340.1-1615s1c1
Sequence:CCGGCGGTCCATGAGCAGCGCCGATCTCGAGATCGGCGCTGCTCATGGACCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)