EMAIL THIS PAGE TO A FRIEND

BAIAP2L1

BAI1-associated protein 2-like 1

58 Gene Product Result for
Synonyms: IRTKS
Gene ID:
Human(55971) Summary: This gene encodes a member of the IMD (IRSp53/MIM homology domain) family. Members of this family can be subdivided in two groups, the IRSp53-like and MIM-like, based on the presence or absence of the SH3 (Src homology 3) domain. The protein encoded by this gene contains a conserved IMD, also known as F-actin bundling domain, at the N-terminus, and a canonical SH3 domain near the C-terminus, so it belongs to the IRSp53-like group. This protein is the substrate for insulin receptor tyrosine kinase and binds to the small GTPase Rac. It is involved in signal transduction pathways that link deformation of the plasma membrane and remodeling of the actin cytoskeleton. It also promotes actin assembly and membrane protrusions when overexpressed in mammalian cells, and is essential to the formation of a potent actin assembly complex during EHEC (Enterohemorrhagic Escherichia coli) pedestal formation. [provided by RefSeq, Oct 2009]
Mouse(66898) BAI1-associated protein 2-like 1
Rat(304282) BAI1-associated protein 2-like 1
chicken(416437) BAI1-associated protein 2-like 1
dog(479748) BAI1-associated protein 2-like 1
cow(615412) BAI1-associated protein 2-like 1
domestic cat(101098023) BAI1-associated protein 2-like 1
naked mole-rat(101719088) BAI1-associated protein 2-like 1
domestic guinea pig(100724572) BAI1-associated protein 2-like 1
sheep(101114328) BAI1-associated protein 2-like 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025833 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025833 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025833 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018842 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018842 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018842 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018842 Rosetta Predictions human pricing
NM_001034140 Rosetta Predictions rat pricing
NM_025833 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018842 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131257 predicted 459
2 SASI_Hs01_00131258 predicted 851
3 SASI_Hs02_00352296 predicted 819
4 SASI_Hs01_00131259 predicted 326
5 SASI_Hs01_00131260 predicted 1139
6 SASI_Hs01_00131261 predicted 547
7 SASI_Hs01_00131262 predicted 343
8 SASI_Hs01_00131263 predicted 757
9 SASI_Hs01_00131264 predicted 1484
10 SASI_Hs02_00352297 predicted 1021
11 SASI_Hs01_00131265 predicted 709
12 SASI_Hs01_00131266 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034140 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054771 predicted 588
2 SASI_Rn01_00054772 predicted 1649
3 SASI_Rn01_00054773 predicted 828
4 SASI_Rn01_00054774 predicted 918
5 SASI_Rn01_00054775 predicted 1686
6 SASI_Rn01_00054776 predicted 353
7 SASI_Rn01_00054778 predicted 1505
8 SASI_Rn02_00203993 predicted 346
9 SASI_Rn01_00054779 predicted 701
10 SASI_Rn01_00054780 predicted 958
11 SASI_Rn01_00054777 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025833 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157566 predicted 909
2 SASI_Mm01_00157567 predicted 1546
3 SASI_Mm01_00157568 predicted 313
4 SASI_Mm01_00157569 predicted 514
5 SASI_Mm01_00157570 predicted 1075
6 SASI_Mm02_00329104 predicted 1148
7 SASI_Mm02_00329105 predicted 1481
8 SASI_Mm01_00157571 predicted 393
9 SASI_Mm01_00157572 predicted 733
10 SASI_Mm01_00157573 predicted 943
11 SASI_Mm01_00157564 predicted 613
12 SASI_Mm01_00157565 predicted 879
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025833
VALIDATED
BAIAP2L1 MISSION shRNA Bacterial Glycerol Stock
BAI1-associated protein 2-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000088794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025833.2-729s1c1
Sequence:CCGGGCACTCAAATACGAGCACAAACTCGAGTTTGTGCTCGTATTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025833.2-882s1c1
Sequence:CCGGGCCAGTCACATACACTACTATCTCGAGATAGTAGTGTATGTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025833.2-320s1c1
Sequence:CCGGCCGGAATGTGATGGAACAATTCTCGAGAATTGTTCCATCACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025833.2-741s1c1
Sequence:CCGGGAGCACAAAGAAATTGAGTATCTCGAGATACTCAATTTCTTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025833.2-2348s1c1
Sequence:CCGGCCAACCTCATTGACAGGCATTCTCGAGAATGCCTGTCAATGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-2116s21c1
Sequence:CCGGATAAGGGATAGTCGGTGTATGCTCGAGCATACACCGACTATCCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-1321s21c1
Sequence:CCGGTCACACGGCTGGCAACAATAACTCGAGTTATTGTTGCCAGCCGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-740s21c1
Sequence:CCGGGAGCACAAAGAAATTGAGTATCTCGAGATACTCAATTTCTTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-881s21c1
Sequence:CCGGGCCAGTCACATACACTACTATCTCGAGATAGTAGTGTATGTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-319s21c1
Sequence:CCGGCCGGAATGTGATGGAACAATTCTCGAGAATTGTTCCATCACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025833
VALIDATED
BAIAP2L1 MISSION shRNA shRNA Plasmid DNA
BAI1-associated protein 2-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000088794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025833.2-729s1c1
Sequence:CCGGGCACTCAAATACGAGCACAAACTCGAGTTTGTGCTCGTATTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025833.2-882s1c1
Sequence:CCGGGCCAGTCACATACACTACTATCTCGAGATAGTAGTGTATGTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025833.2-320s1c1
Sequence:CCGGCCGGAATGTGATGGAACAATTCTCGAGAATTGTTCCATCACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025833.2-741s1c1
Sequence:CCGGGAGCACAAAGAAATTGAGTATCTCGAGATACTCAATTTCTTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025833.2-2348s1c1
Sequence:CCGGCCAACCTCATTGACAGGCATTCTCGAGAATGCCTGTCAATGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-2116s21c1
Sequence:CCGGATAAGGGATAGTCGGTGTATGCTCGAGCATACACCGACTATCCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-1321s21c1
Sequence:CCGGTCACACGGCTGGCAACAATAACTCGAGTTATTGTTGCCAGCCGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-740s21c1
Sequence:CCGGGAGCACAAAGAAATTGAGTATCTCGAGATACTCAATTTCTTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-881s21c1
Sequence:CCGGGCCAGTCACATACACTACTATCTCGAGATAGTAGTGTATGTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-319s21c1
Sequence:CCGGCCGGAATGTGATGGAACAATTCTCGAGAATTGTTCCATCACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025833
VALIDATED
BAIAP2L1 MISSION shRNA Lentiviral Transduction Particles
BAI1-associated protein 2-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000088794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025833.2-729s1c1
Sequence:CCGGGCACTCAAATACGAGCACAAACTCGAGTTTGTGCTCGTATTTGAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088796    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025833.2-882s1c1
Sequence:CCGGGCCAGTCACATACACTACTATCTCGAGATAGTAGTGTATGTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025833.2-320s1c1
Sequence:CCGGCCGGAATGTGATGGAACAATTCTCGAGAATTGTTCCATCACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088797    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025833.2-741s1c1
Sequence:CCGGGAGCACAAAGAAATTGAGTATCTCGAGATACTCAATTTCTTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025833.2-2348s1c1
Sequence:CCGGCCAACCTCATTGACAGGCATTCTCGAGAATGCCTGTCAATGAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294934    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-2116s21c1
Sequence:CCGGATAAGGGATAGTCGGTGTATGCTCGAGCATACACCGACTATCCCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-1321s21c1
Sequence:CCGGTCACACGGCTGGCAACAATAACTCGAGTTATTGTTGCCAGCCGTGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-740s21c1
Sequence:CCGGGAGCACAAAGAAATTGAGTATCTCGAGATACTCAATTTCTTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-881s21c1
Sequence:CCGGGCCAGTCACATACACTACTATCTCGAGATAGTAGTGTATGTGACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025833.3-319s21c1
Sequence:CCGGCCGGAATGTGATGGAACAATTCTCGAGAATTGTTCCATCACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018842
VALIDATED
BAIAP2L1 MISSION shRNA Bacterial Glycerol Stock
BAI1-associated protein 2-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000005347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018842.3-264s1c1
Sequence:CCGGCCGGAATGTTATGGAACAGTTCTCGAGAACTGTTCCATAACATTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018842.3-724s1c1
Sequence:CCGGCGTCAGAGTGAAATCCAGAAACTCGAGTTTCTGGATTTCACTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018842.3-1892s1c1
Sequence:CCGGGCTTCTCTGTTTCACGTAGTTCTCGAGAACTACGTGAAACAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018842.3-1186s1c1
Sequence:CCGGCCCAGTTTACAGCGATCAGTTCTCGAGAACTGATCGCTGTAAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018842.3-1044s1c1
Sequence:CCGGCCTTTCTAAATGCTCACCAAACTCGAGTTTGGTGAGCATTTAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-1892s21c1
Sequence:CCGGGCTTCTCTGTTTCACGTAGTTCTCGAGAACTACGTGAAACAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-537s21c1
Sequence:CCGGGATAGAACTTGACGTGAAATACTCGAGTATTTCACGTCAAGTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-664s21c1
Sequence:CCGGAGCCGAAACGCACTCAAATATCTCGAGATATTTGAGTGCGTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-724s21c1
Sequence:CCGGCGTCAGAGTGAAATCCAGAAACTCGAGTTTCTGGATTTCACTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-264s21c1
Sequence:CCGGCCGGAATGTTATGGAACAGTTCTCGAGAACTGTTCCATAACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018842
VALIDATED
BAIAP2L1 MISSION shRNA shRNA Plasmid DNA
BAI1-associated protein 2-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000005347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018842.3-264s1c1
Sequence:CCGGCCGGAATGTTATGGAACAGTTCTCGAGAACTGTTCCATAACATTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018842.3-724s1c1
Sequence:CCGGCGTCAGAGTGAAATCCAGAAACTCGAGTTTCTGGATTTCACTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018842.3-1892s1c1
Sequence:CCGGGCTTCTCTGTTTCACGTAGTTCTCGAGAACTACGTGAAACAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018842.3-1186s1c1
Sequence:CCGGCCCAGTTTACAGCGATCAGTTCTCGAGAACTGATCGCTGTAAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018842.3-1044s1c1
Sequence:CCGGCCTTTCTAAATGCTCACCAAACTCGAGTTTGGTGAGCATTTAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-1892s21c1
Sequence:CCGGGCTTCTCTGTTTCACGTAGTTCTCGAGAACTACGTGAAACAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-537s21c1
Sequence:CCGGGATAGAACTTGACGTGAAATACTCGAGTATTTCACGTCAAGTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-664s21c1
Sequence:CCGGAGCCGAAACGCACTCAAATATCTCGAGATATTTGAGTGCGTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-724s21c1
Sequence:CCGGCGTCAGAGTGAAATCCAGAAACTCGAGTTTCTGGATTTCACTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-264s21c1
Sequence:CCGGCCGGAATGTTATGGAACAGTTCTCGAGAACTGTTCCATAACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018842
VALIDATED
BAIAP2L1 MISSION shRNA Lentiviral Transduction Particles
BAI1-associated protein 2-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000005347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_018842.3-264s1c1
Sequence:CCGGCCGGAATGTTATGGAACAGTTCTCGAGAACTGTTCCATAACATTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005350    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_018842.3-724s1c1
Sequence:CCGGCGTCAGAGTGAAATCCAGAAACTCGAGTTTCTGGATTTCACTCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005346    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_018842.3-1892s1c1
Sequence:CCGGGCTTCTCTGTTTCACGTAGTTCTCGAGAACTACGTGAAACAGAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018842.3-1186s1c1
Sequence:CCGGCCCAGTTTACAGCGATCAGTTCTCGAGAACTGATCGCTGTAAACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018842.3-1044s1c1
Sequence:CCGGCCTTTCTAAATGCTCACCAAACTCGAGTTTGGTGAGCATTTAGAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273554    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-1892s21c1
Sequence:CCGGGCTTCTCTGTTTCACGTAGTTCTCGAGAACTACGTGAAACAGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-537s21c1
Sequence:CCGGGATAGAACTTGACGTGAAATACTCGAGTATTTCACGTCAAGTTCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273497    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-664s21c1
Sequence:CCGGAGCCGAAACGCACTCAAATATCTCGAGATATTTGAGTGCGTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-724s21c1
Sequence:CCGGCGTCAGAGTGAAATCCAGAAACTCGAGTTTCTGGATTTCACTCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_018842.3-264s21c1
Sequence:CCGGCCGGAATGTTATGGAACAGTTCTCGAGAACTGTTCCATAACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks