EMAIL THIS PAGE TO A FRIEND

BAIAP2L2

BAI1-associated protein 2-like 2

74 Gene Product Result for
UniProtKB ID: Q6UXY1, B0QYE2, Q96BG7
Gene ID:
Human(80115) Summary: The protein encoded by this gene binds phosphoinositides and promotes the formation of planar or curved membrane structures. The encoded protein is found in RAB13-positive vesicles and at intercellular contacts with the plasma membrane. [provided by RefSeq, Dec 2012]
Mouse(207495) BAI1-associated protein 2-like 2
Rat(685357) BAI1-associated protein 2-like 2
Zebrafish(564798) BAI1-associated protein 2-like 2
chicken(418029) BAI1-associated protein 2-like 2
dog(610178) BAI1-associated protein 2-like 2
domestic cat(101095112) BAI1-associated protein 2-like 2
cow(617924) BAI1-associated protein 2-like 2
sheep(101120915) BAI1-associated protein 2-like 2
domestic guinea pig(100733133) BAI1-associated protein 2-like 2
naked mole-rat(101711513) BAI1-associated protein 2-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025045 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025045 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025045 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177580 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177580 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177580 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU063151 MISSION® esiRNA esiRNA targeting mouse Baiap2l2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025045 Rosetta Predictions human pricing
XM_001063469 Rosetta Predictions rat pricing
NM_177580 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025045 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138854 predicted 713
2 SASI_Hs01_00138855 predicted 686
3 SASI_Hs01_00138856 predicted 720
4 SASI_Hs01_00138857 predicted 465
5 SASI_Hs01_00138858 predicted 280
6 SASI_Hs01_00138859 predicted 1588
7 SASI_Hs01_00138860 predicted 654
8 SASI_Hs01_00138861 predicted 232
9 SASI_Hs01_00138862 predicted 470
10 SASI_Hs01_00138863 predicted 583
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063469 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307236 predicted 1085
2 SASI_Rn02_00307237 predicted 1175
3 SASI_Rn02_00307238 predicted 1344
4 SASI_Rn02_00307239 predicted 1368
5 SASI_Rn02_00307240 predicted 1343
6 SASI_Rn02_00307241 predicted 1328
7 SASI_Rn02_00307242 predicted 1212
8 SASI_Rn02_00307243 predicted 1269
9 SASI_Rn02_00307244 predicted 1377
10 SASI_Rn02_00307245 predicted 1344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177580 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140169 predicted 1155
2 SASI_Mm02_00347750 predicted 1237
3 SASI_Mm01_00140170 predicted 469
4 SASI_Mm02_00347751 predicted 208
5 SASI_Mm02_00347752 predicted 571
6 SASI_Mm01_00140173 predicted 437
7 SASI_Mm01_00140175 predicted 265
8 SASI_Mm01_00140176 predicted 310
9 SASI_Mm01_00140177 predicted 1204
10 SASI_Mm01_00140178 predicted 1052
11 SASI_Mm01_00140171 predicted 647
12 SASI_Mm01_00140172 predicted 1130
13 SASI_Mm01_00140174 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025045
BAIAP2L2 MISSION shRNA Bacterial Glycerol Stock
BAI1-associated protein 2-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025045.4-574s21c1
Sequence:CCGGGAGCGCAAGAGAGACAAGAACCTCGAGGTTCTTGTCTCTCTTGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025045.4-364s21c1
Sequence:CCGGATCTTGGTGCAGATGTCTGACCTCGAGGTCAGACATCTGCACCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-1541s1c1
Sequence:CCGGCCACTGACGTCAAGAAACTGACTCGAGTCAGTTTCTTGACGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-447s1c1
Sequence:CCGGGCTGGACATGCAGTTCATCAACTCGAGTTGATGAACTGCATGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-435s1c1
Sequence:CCGGGAAGAACACCAAGCTGGACATCTCGAGATGTCCAGCTTGGTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-168s1c1
Sequence:CCGGCAAGAGCATCATGGAGCAGTTCTCGAGAACTGCTCCATGATGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-669s1c1
Sequence:CCGGCTATCGCTTCCTAGCAGAGAACTCGAGTTCTCTGCTAGGAAGCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025045
BAIAP2L2 MISSION shRNA shRNA Plasmid DNA
BAI1-associated protein 2-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025045.4-574s21c1
Sequence:CCGGGAGCGCAAGAGAGACAAGAACCTCGAGGTTCTTGTCTCTCTTGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025045.4-364s21c1
Sequence:CCGGATCTTGGTGCAGATGTCTGACCTCGAGGTCAGACATCTGCACCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-1541s1c1
Sequence:CCGGCCACTGACGTCAAGAAACTGACTCGAGTCAGTTTCTTGACGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-447s1c1
Sequence:CCGGGCTGGACATGCAGTTCATCAACTCGAGTTGATGAACTGCATGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-435s1c1
Sequence:CCGGGAAGAACACCAAGCTGGACATCTCGAGATGTCCAGCTTGGTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-168s1c1
Sequence:CCGGCAAGAGCATCATGGAGCAGTTCTCGAGAACTGCTCCATGATGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-669s1c1
Sequence:CCGGCTATCGCTTCCTAGCAGAGAACTCGAGTTCTCTGCTAGGAAGCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025045
BAIAP2L2 MISSION shRNA Lentiviral Transduction Particles
BAI1-associated protein 2-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025045.4-574s21c1
Sequence:CCGGGAGCGCAAGAGAGACAAGAACCTCGAGGTTCTTGTCTCTCTTGCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025045.4-364s21c1
Sequence:CCGGATCTTGGTGCAGATGTCTGACCTCGAGGTCAGACATCTGCACCAAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-1541s1c1
Sequence:CCGGCCACTGACGTCAAGAAACTGACTCGAGTCAGTTTCTTGACGTCAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-447s1c1
Sequence:CCGGGCTGGACATGCAGTTCATCAACTCGAGTTGATGAACTGCATGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-435s1c1
Sequence:CCGGGAAGAACACCAAGCTGGACATCTCGAGATGTCCAGCTTGGTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-168s1c1
Sequence:CCGGCAAGAGCATCATGGAGCAGTTCTCGAGAACTGCTCCATGATGCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025045.3-669s1c1
Sequence:CCGGCTATCGCTTCCTAGCAGAGAACTCGAGTTCTCTGCTAGGAAGCGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177580
BAIAP2L2 MISSION shRNA Bacterial Glycerol Stock
BAI1-associated protein 2-like 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177580.3-1900s21c1
Sequence:CCGGTGTTGCTTTCGGGACCCAAAGCTCGAGCTTTGGGTCCCGAAAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177580.3-210s21c1
Sequence:CCGGTGGTGTACCTGGGCAACAACTCTCGAGAGTTGTTGCCCAGGTACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177580.3-151s21c1
Sequence:CCGGGTCCACCATGGCCATCTACAACTCGAGTTGTAGATGGCCATGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177580.2-390s1c1
Sequence:CCGGGACATGCAGTTCATCAAGGATCTCGAGATCCTTGATGAACTGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177580.2-416s1c1
Sequence:CCGGCCAACACTACGAGATTGAGTACTCGAGTACTCAATCTCGTAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177580.2-1496s1c1
Sequence:CCGGCACCGACGTCAAGAAACTTATCTCGAGATAAGTTTCTTGACGTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173826    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177580.2-1861s1c1
Sequence:CCGGCATCTTGCCTTCCATCCTCTTCTCGAGAAGAGGATGGAAGGCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177580
BAIAP2L2 MISSION shRNA shRNA Plasmid DNA
BAI1-associated protein 2-like 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177580.3-1900s21c1
Sequence:CCGGTGTTGCTTTCGGGACCCAAAGCTCGAGCTTTGGGTCCCGAAAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177580.3-210s21c1
Sequence:CCGGTGGTGTACCTGGGCAACAACTCTCGAGAGTTGTTGCCCAGGTACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177580.3-151s21c1
Sequence:CCGGGTCCACCATGGCCATCTACAACTCGAGTTGTAGATGGCCATGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177580.2-390s1c1
Sequence:CCGGGACATGCAGTTCATCAAGGATCTCGAGATCCTTGATGAACTGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177580.2-416s1c1
Sequence:CCGGCCAACACTACGAGATTGAGTACTCGAGTACTCAATCTCGTAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177580.2-1496s1c1
Sequence:CCGGCACCGACGTCAAGAAACTTATCTCGAGATAAGTTTCTTGACGTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173826    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177580.2-1861s1c1
Sequence:CCGGCATCTTGCCTTCCATCCTCTTCTCGAGAAGAGGATGGAAGGCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177580
BAIAP2L2 MISSION shRNA Lentiviral Transduction Particles
BAI1-associated protein 2-like 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436337    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177580.3-1900s21c1
Sequence:CCGGTGTTGCTTTCGGGACCCAAAGCTCGAGCTTTGGGTCCCGAAAGCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177580.3-210s21c1
Sequence:CCGGTGGTGTACCTGGGCAACAACTCTCGAGAGTTGTTGCCCAGGTACACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177580.3-151s21c1
Sequence:CCGGGTCCACCATGGCCATCTACAACTCGAGTTGTAGATGGCCATGGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177580.2-390s1c1
Sequence:CCGGGACATGCAGTTCATCAAGGATCTCGAGATCCTTGATGAACTGCATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177580.2-416s1c1
Sequence:CCGGCCAACACTACGAGATTGAGTACTCGAGTACTCAATCTCGTAGTGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194359    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177580.2-1496s1c1
Sequence:CCGGCACCGACGTCAAGAAACTTATCTCGAGATAAGTTTCTTGACGTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173826    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177580.2-1861s1c1
Sequence:CCGGCATCTTGCCTTCCATCCTCTTCTCGAGAAGAGGATGGAAGGCAAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks