EMAIL THIS PAGE TO A FRIEND

BAIAP3

BAI1-associated protein 3

38 Gene Product Result for
Synonyms: BAP3
Gene ID:
Human(8938) Summary: This p53-target gene encodes a brain-specific angiogenesis inhibitor. The protein is a seven-span transmembrane protein and a member of the secretin receptor family. It interacts with the cytoplasmic region of brain-specific angiogenesis inhibitor 1. This protein also contains two C2 domains, which are often found in proteins involved in signal transduction or membrane trafficking. Its expression pattern and similarity to other proteins suggest that it may be involved in synaptic functions. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
Mouse(545192) BAI1-associated protein 3
Rat(302988) BAI1-associated protein 3
naked mole-rat(101717105) BAI1-associated protein 3
domestic guinea pig(100722487) BAI1-associated protein 3
sheep(101107923) BAI1-associated protein 3
Zebrafish(564728) BAI1-associated protein 3
dog(490079) BAI1-associated protein 3
cow(100847576) BAI1-associated protein 3
domestic cat(101088806) BAI1-associated protein 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003933 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003933 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003933 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003933 Rosetta Predictions human pricing
XM_619443 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003933 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039161 predicted 2586
2 SASI_Hs01_00039162 predicted 3229
3 SASI_Hs01_00039163 predicted 2613
4 SASI_Hs01_00039164 predicted 1496
5 SASI_Hs01_00039165 predicted 432
6 SASI_Hs01_00039166 predicted 1829
7 SASI_Hs01_00039167 predicted 2914
8 SASI_Hs01_00039168 predicted 2612
9 SASI_Hs01_00039170 predicted 500
10 SASI_Hs02_00336581 predicted 881
11 SASI_Hs01_00039169 predicted 2351
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_619443 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00427409 predicted 3146
2 SASI_Mm02_00427410 predicted 886
3 SASI_Mm02_00427411 predicted 1733
4 SASI_Mm02_00427412 predicted 2600
5 SASI_Mm02_00427413 predicted 975
6 SASI_Mm02_00427414 predicted 523
7 SASI_Mm02_00427415 predicted 627
8 SASI_Mm02_00427416 predicted 994
9 SASI_Mm02_00427417 predicted 1880
10 SASI_Mm02_00427418 predicted 2544
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003933
BAIAP3 MISSION shRNA Bacterial Glycerol Stock
BAI1-associated protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003933.3-823s1c1
Sequence:CCGGGAGCACTTCCTCTTCGAGATTCTCGAGAATCTCGAAGAGGAAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003933.3-1852s1c1
Sequence:CCGGCTCTTCCACAGCATCCTCAATCTCGAGATTGAGGATGCTGTGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-2332s1c1
Sequence:CCGGCTCTTCTATACGGAGCTGCTTCTCGAGAAGCAGCTCCGTATAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-1808s1c1
Sequence:CCGGCCGTCTATGATGACCTTCAGTCTCGAGACTGAAGGTCATCATAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-960s1c1
Sequence:CCGGGTACTTCAAACAGATCGTCAACTCGAGTTGACGATCTGTTTGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-108s1c1
Sequence:CCGGGTCGACCTTGCTGGACATTAACTCGAGTTAATGTCCAGCAAGGTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-892s1c1
Sequence:CCGGGACGATGTATCCCTGGTAGAACTCGAGTTCTACCAGGGATACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003933.3-1724s21c1
Sequence:CCGGGGTACGACAGGATCCTGAATGCTCGAGCATTCAGGATCCTGTCGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003933.3-2408s21c1
Sequence:CCGGTCTGCGTGGTCCTCAACAATGCTCGAGCATTGTTGAGGACCACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003933.3-3948s21c1
Sequence:CCGGGGGCAATGTGCAGACGCATTTCTCGAGAAATGCGTCTGCACATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003933.3-500s21c1
Sequence:CCGGGCTATCTCCAGCAGGTGTTTGCTCGAGCAAACACCTGCTGGAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003933
BAIAP3 MISSION shRNA shRNA Plasmid DNA
BAI1-associated protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003933.3-823s1c1
Sequence:CCGGGAGCACTTCCTCTTCGAGATTCTCGAGAATCTCGAAGAGGAAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003933.3-1852s1c1
Sequence:CCGGCTCTTCCACAGCATCCTCAATCTCGAGATTGAGGATGCTGTGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-2332s1c1
Sequence:CCGGCTCTTCTATACGGAGCTGCTTCTCGAGAAGCAGCTCCGTATAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-1808s1c1
Sequence:CCGGCCGTCTATGATGACCTTCAGTCTCGAGACTGAAGGTCATCATAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-960s1c1
Sequence:CCGGGTACTTCAAACAGATCGTCAACTCGAGTTGACGATCTGTTTGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-108s1c1
Sequence:CCGGGTCGACCTTGCTGGACATTAACTCGAGTTAATGTCCAGCAAGGTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-892s1c1
Sequence:CCGGGACGATGTATCCCTGGTAGAACTCGAGTTCTACCAGGGATACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003933.3-1724s21c1
Sequence:CCGGGGTACGACAGGATCCTGAATGCTCGAGCATTCAGGATCCTGTCGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003933.3-2408s21c1
Sequence:CCGGTCTGCGTGGTCCTCAACAATGCTCGAGCATTGTTGAGGACCACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003933.3-3948s21c1
Sequence:CCGGGGGCAATGTGCAGACGCATTTCTCGAGAAATGCGTCTGCACATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003933.3-500s21c1
Sequence:CCGGGCTATCTCCAGCAGGTGTTTGCTCGAGCAAACACCTGCTGGAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003933
BAIAP3 MISSION shRNA Lentiviral Transduction Particles
BAI1-associated protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130755    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003933.3-823s1c1
Sequence:CCGGGAGCACTTCCTCTTCGAGATTCTCGAGAATCTCGAAGAGGAAGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127610    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003933.3-1852s1c1
Sequence:CCGGCTCTTCCACAGCATCCTCAATCTCGAGATTGAGGATGCTGTGGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-2332s1c1
Sequence:CCGGCTCTTCTATACGGAGCTGCTTCTCGAGAAGCAGCTCCGTATAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-1808s1c1
Sequence:CCGGCCGTCTATGATGACCTTCAGTCTCGAGACTGAAGGTCATCATAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-960s1c1
Sequence:CCGGGTACTTCAAACAGATCGTCAACTCGAGTTGACGATCTGTTTGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127970    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-108s1c1
Sequence:CCGGGTCGACCTTGCTGGACATTAACTCGAGTTAATGTCCAGCAAGGTCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003933.3-892s1c1
Sequence:CCGGGACGATGTATCCCTGGTAGAACTCGAGTTCTACCAGGGATACATCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436506    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003933.3-1724s21c1
Sequence:CCGGGGTACGACAGGATCCTGAATGCTCGAGCATTCAGGATCCTGTCGTACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003933.3-2408s21c1
Sequence:CCGGTCTGCGTGGTCCTCAACAATGCTCGAGCATTGTTGAGGACCACGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421038    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003933.3-3948s21c1
Sequence:CCGGGGGCAATGTGCAGACGCATTTCTCGAGAAATGCGTCTGCACATTGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003933.3-500s21c1
Sequence:CCGGGCTATCTCCAGCAGGTGTTTGCTCGAGCAAACACCTGCTGGAGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks