EMAIL THIS PAGE TO A FRIEND

BAK1

BCL2-antagonist/killer 1

92 Gene Product Result for
Synonyms: BAK BAK-LIKE BCL2L7 CDN1
UniProtKB ID: Q16611, Q6I9T6, Q92533
Gene ID:
Human(578) Summary: The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form oligomers or heterodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein localizes to mitochondria, and functions to induce apoptosis. It interacts with and accelerates the opening of the mitochondrial voltage-dependent anion channel, which leads to a loss in membrane potential and the release of cytochrome c. This protein also interacts with the tumor suppressor P53 after exposure to cell stress. [provided by RefSeq, Jul 2008]
Mouse(12018) BCL2-antagonist/killer 1
Rat(116502) BCL2-antagonist/killer 1
domestic guinea pig(100734553) BCL2-antagonist/killer 1
Thale Cress(829480) Leu-rich receptor Serine/threonine protein kinase BAK1
cow(514090) BCL2-antagonist/killer 1
domestic cat(768278) BCL2-antagonist/killer 1
domestic cat(101093435) BCL2-antagonist/killer 1
dog(481744) BCL2-antagonist/killer 1
chicken(419912) BCL2-antagonist/killer 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Cell Lines

Product # Description Species Add to Cart
 
CLLS1005 DLD1 Cells BAX/BAK (-/-,-/-) human pricing
CLLS1011 SW48 Cells BAX/BAK (-/-,-/-) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007523 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007523 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007523 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001188 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001188 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001188 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001188 Rosetta Predictions human pricing
NM_053812 Rosetta Predictions rat pricing
NM_007523 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001188 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00331326 predicted 983
2 SASI_Hs01_00075044 predicted 848
3 SASI_Hs02_00331327 predicted 870
4 SASI_Hs01_00075045 predicted 1106
5 SASI_Hs01_00075046 predicted 1404
6 SASI_Hs01_00075047 predicted 648
7 SASI_Hs01_00075048 predicted 913
8 SASI_Hs01_00075049 predicted 625
9 SASI_Hs01_00075050 predicted 687
10 SASI_Hs01_00075051 predicted 610
11 SASI_Hs01_00075052 predicted 942
12 SASI_Hs01_00075053 predicted 1034
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053812 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059775 predicted 517
2 SASI_Rn01_00059776 predicted 572
3 SASI_Rn01_00059777 predicted 542
4 SASI_Rn01_00059778 predicted 735
5 SASI_Rn01_00059779 predicted 853
6 SASI_Rn02_00266638 predicted 820
7 SASI_Rn01_00059780 predicted 470
8 SASI_Rn01_00059781 predicted 414
9 SASI_Rn01_00059782 predicted 498
10 SASI_Rn02_00266639 predicted 308
11 SASI_Rn01_00059783 predicted 572
12 SASI_Rn01_00059784 predicted 480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007523 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141121 predicted 558
2 SASI_Mm01_00141123 predicted 443
3 SASI_Mm01_00141124 predicted 341
4 SASI_Mm01_00141125 predicted 520
5 SASI_Mm02_00311829 predicted 475
6 SASI_Mm01_00141127 predicted 592
7 SASI_Mm01_00141129 predicted 273
8 SASI_Mm02_00311830 predicted 552
9 SASI_Mm02_00311831 predicted 342
10 SASI_Mm02_00311832 predicted 551
11 SASI_Mm01_00141120 predicted 576
12 SASI_Mm01_00141122 predicted 1366
13 SASI_Mm01_00141126 predicted 1356
14 SASI_Mm01_00141128 predicted 519
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007523
BAK1 MISSION shRNA Bacterial Glycerol Stock
BCL2-antagonist/killer 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000428089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007523.2-1184s21c1
Sequence:CCGGTACTACCCTTTAGATACAATCCTCGAGGATTGTATCTAAAGGGTAGTATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007523.2-1330s21c1
Sequence:CCGGATCCTTGCCCTCCCTACATTGCTCGAGCAATGTAGGGAGGGCAAGGATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007523.2-810s21c1
Sequence:CCGGTCCTGACCGTAATGGTGATTTCTCGAGAAATCACCATTACGGTCAGGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007523.1-1807s1c1
Sequence:CCGGCGGAACCTATGATTACTTGAACTCGAGTTCAAGTAATCATAGGTTCCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-733s1c1
Sequence:CCGGTGCATCATTACATCGCCAGATCTCGAGATCTGGCGATGTAATGATGCATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-833s1c1
Sequence:CCGGTGTGGTTCTGTTGGGCCAATTCTCGAGAATTGGCCCAACAGAACCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-477s1c1
Sequence:CCGGCTTGCTCTCATCGGAGATGATCTCGAGATCATCTCCGATGAGAGCAAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-593s1c1
Sequence:CCGGCAGCCTATTTAAGAGTGGCATCTCGAGATGCCACTCTTAAATAGGCTGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007523
BAK1 MISSION shRNA shRNA Plasmid DNA
BCL2-antagonist/killer 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000428089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007523.2-1184s21c1
Sequence:CCGGTACTACCCTTTAGATACAATCCTCGAGGATTGTATCTAAAGGGTAGTATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007523.2-1330s21c1
Sequence:CCGGATCCTTGCCCTCCCTACATTGCTCGAGCAATGTAGGGAGGGCAAGGATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000427732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007523.2-810s21c1
Sequence:CCGGTCCTGACCGTAATGGTGATTTCTCGAGAAATCACCATTACGGTCAGGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007523.1-1807s1c1
Sequence:CCGGCGGAACCTATGATTACTTGAACTCGAGTTCAAGTAATCATAGGTTCCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-733s1c1
Sequence:CCGGTGCATCATTACATCGCCAGATCTCGAGATCTGGCGATGTAATGATGCATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-833s1c1
Sequence:CCGGTGTGGTTCTGTTGGGCCAATTCTCGAGAATTGGCCCAACAGAACCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-477s1c1
Sequence:CCGGCTTGCTCTCATCGGAGATGATCTCGAGATCATCTCCGATGAGAGCAAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-593s1c1
Sequence:CCGGCAGCCTATTTAAGAGTGGCATCTCGAGATGCCACTCTTAAATAGGCTGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007523
BAK1 MISSION shRNA Lentiviral Transduction Particles
BCL2-antagonist/killer 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000428089    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007523.2-1184s21c1
Sequence:CCGGTACTACCCTTTAGATACAATCCTCGAGGATTGTATCTAAAGGGTAGTATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423171    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007523.2-1330s21c1
Sequence:CCGGATCCTTGCCCTCCCTACATTGCTCGAGCAATGTAGGGAGGGCAAGGATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000427732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007523.2-810s21c1
Sequence:CCGGTCCTGACCGTAATGGTGATTTCTCGAGAAATCACCATTACGGTCAGGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009673    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007523.1-1807s1c1
Sequence:CCGGCGGAACCTATGATTACTTGAACTCGAGTTCAAGTAATCATAGGTTCCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-733s1c1
Sequence:CCGGTGCATCATTACATCGCCAGATCTCGAGATCTGGCGATGTAATGATGCATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-833s1c1
Sequence:CCGGTGTGGTTCTGTTGGGCCAATTCTCGAGAATTGGCCCAACAGAACCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009675    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-477s1c1
Sequence:CCGGCTTGCTCTCATCGGAGATGATCTCGAGATCATCTCCGATGAGAGCAAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007523.1-593s1c1
Sequence:CCGGCAGCCTATTTAAGAGTGGCATCTCGAGATGCCACTCTTAAATAGGCTGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001188
VALIDATED
BAK1 MISSION shRNA Bacterial Glycerol Stock
BCL2-antagonist/killer 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-911s21c1
Sequence:CCGGTGGTACGAAGATTCTTCAAATCTCGAGATTTGAAGAATCTTCGTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-548s21c1
Sequence:CCGGACGACATCAACCGACGCTATGCTCGAGCATAGCGTCGGTTGATGTCGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-623s21c1
Sequence:CCGGATGAGTACTTCACCAAGATTGCTCGAGCAATCTTGGTGAAGTACTCATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001188.3-1861s21c1
Sequence:CCGGCTAAGTGGGAGAAGGACTATCCTCGAGGATAGTCCTTCTCCCACTTAGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-654s21c1
Sequence:CCGGGTTTGAGAGTGGCATCAATTGCTCGAGCAATTGATGCCACTCTCAAACTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-562s1c1
Sequence:CCGGCCTGTTTGAGAGTGGCATCAACTCGAGTTGATGCCACTCTCAAACAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-469s1c1
Sequence:CCGGCCGACGCTATGACTCAGAGTTCTCGAGAACTCTGAGTCATAGCGTCGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-626s1c1
Sequence:CCGGGCCCTACACGTCTACCAGCATCTCGAGATGCTGGTAGACGTGTAGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-515s1c1
Sequence:CCGGCCCACGGCAGAGAATGCCTATCTCGAGATAGGCATTCTCTGCCGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001188.2-822s1c1
Sequence:CCGGTGGTACGAAGATTCTTCAAATCTCGAGATTTGAAGAATCTTCGTACCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001188
VALIDATED
BAK1 MISSION shRNA shRNA Plasmid DNA
BCL2-antagonist/killer 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-911s21c1
Sequence:CCGGTGGTACGAAGATTCTTCAAATCTCGAGATTTGAAGAATCTTCGTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-548s21c1
Sequence:CCGGACGACATCAACCGACGCTATGCTCGAGCATAGCGTCGGTTGATGTCGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-623s21c1
Sequence:CCGGATGAGTACTTCACCAAGATTGCTCGAGCAATCTTGGTGAAGTACTCATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001188.3-1861s21c1
Sequence:CCGGCTAAGTGGGAGAAGGACTATCCTCGAGGATAGTCCTTCTCCCACTTAGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000234975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-654s21c1
Sequence:CCGGGTTTGAGAGTGGCATCAATTGCTCGAGCAATTGATGCCACTCTCAAACTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-562s1c1
Sequence:CCGGCCTGTTTGAGAGTGGCATCAACTCGAGTTGATGCCACTCTCAAACAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-469s1c1
Sequence:CCGGCCGACGCTATGACTCAGAGTTCTCGAGAACTCTGAGTCATAGCGTCGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-626s1c1
Sequence:CCGGGCCCTACACGTCTACCAGCATCTCGAGATGCTGGTAGACGTGTAGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-515s1c1
Sequence:CCGGCCCACGGCAGAGAATGCCTATCTCGAGATAGGCATTCTCTGCCGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001188.2-822s1c1
Sequence:CCGGTGGTACGAAGATTCTTCAAATCTCGAGATTTGAAGAATCTTCGTACCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001188
VALIDATED
BAK1 MISSION shRNA Lentiviral Transduction Particles
BCL2-antagonist/killer 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234976    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-911s21c1
Sequence:CCGGTGGTACGAAGATTCTTCAAATCTCGAGATTTGAAGAATCTTCGTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-548s21c1
Sequence:CCGGACGACATCAACCGACGCTATGCTCGAGCATAGCGTCGGTTGATGTCGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-623s21c1
Sequence:CCGGATGAGTACTTCACCAAGATTGCTCGAGCAATCTTGGTGAAGTACTCATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234977    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001188.3-1861s21c1
Sequence:CCGGCTAAGTGGGAGAAGGACTATCCTCGAGGATAGTCCTTCTCCCACTTAGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000234975    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001188.3-654s21c1
Sequence:CCGGGTTTGAGAGTGGCATCAATTGCTCGAGCAATTGATGCCACTCTCAAACTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-562s1c1
Sequence:CCGGCCTGTTTGAGAGTGGCATCAACTCGAGTTGATGCCACTCTCAAACAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-469s1c1
Sequence:CCGGCCGACGCTATGACTCAGAGTTCTCGAGAACTCTGAGTCATAGCGTCGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-626s1c1
Sequence:CCGGGCCCTACACGTCTACCAGCATCTCGAGATGCTGGTAGACGTGTAGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033468    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001188.2-515s1c1
Sequence:CCGGCCCACGGCAGAGAATGCCTATCTCGAGATAGGCATTCTCTGCCGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_001188.2-822s1c1
Sequence:CCGGTGGTACGAAGATTCTTCAAATCTCGAGATTTGAAGAATCTTCGTACCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)