EMAIL THIS PAGE TO A FRIEND

BAMBI

BMP and activin membrane-bound inhibitor

133 Gene Product Result for
Synonyms: NMA
UniProtKB ID: Q13145
Gene ID:
Human(25805) Summary: This gene encodes a transmembrane glycoprotein related to the type I receptors of the transforming growth factor-beta (TGF-beta) family, whose members play important roles in signal transduction in many developmental and pathological processes. The encoded protein however is a pseudoreceptor, lacking an intracellular serine/threonine kinase domain required for signaling. Similar proteins in frog, mouse and zebrafish function as negative regulators of TGF-beta, which has led to the suggestion that the encoded protein may function to limit the signaling range of the TGF-beta family during early embryogenesis. [provided by RefSeq, Jul 2008]
Mouse(68010) BMP and activin membrane-bound inhibitor
Rat(83837) BMP and activin membrane-bound inhibitor
chicken(428413) BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
dog(487081) BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
cow(530147) BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
naked mole-rat(101708610) BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
domestic guinea pig(100730544) BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
sheep(443242) BMP and activin membrane-bound inhibitor homolog (Xenopus laevis)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1284 Human BAMBI ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026505 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026505 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026505 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_012342 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012342 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012342 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012342 Rosetta Predictions human pricing
NM_139082 Rosetta Predictions rat pricing
NM_026505 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012342 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198177 predicted 821
2 SASI_Hs01_00198178 predicted 684
3 SASI_Hs01_00198179 predicted 1186
4 SASI_Hs02_00344144 predicted 1184
5 SASI_Hs02_00344145 predicted 1190
6 SASI_Hs02_00344146 predicted 1188
7 SASI_Hs01_00198180 predicted 873
8 SASI_Hs01_00198181 predicted 694
9 SASI_Hs01_00198182 predicted 795
10 SASI_Hs01_00198186 predicted 1205
11 SASI_Hs01_00198183 predicted 646
12 SASI_Hs01_00198184 predicted 1122
13 SASI_Hs01_00198185 predicted 966
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139082 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268435 predicted 286
2 SASI_Rn01_00096344 predicted 401
3 SASI_Rn02_00268436 predicted 575
4 SASI_Rn02_00268437 predicted 521
5 SASI_Rn01_00096350 predicted 360
6 SASI_Rn02_00268438 predicted 462
7 SASI_Rn02_00268439 predicted 572
8 SASI_Rn02_00268440 predicted 481
9 SASI_Rn02_00268441 predicted 235
10 SASI_Rn02_00268442 predicted 600
11 SASI_Rn01_00096343 predicted 398
12 SASI_Rn01_00096345 predicted 1069
13 SASI_Rn01_00096346 predicted 347
14 SASI_Rn01_00096347 predicted 962
15 SASI_Rn01_00096348 predicted 393
16 SASI_Rn01_00096349 predicted 1034
17 SASI_Rn01_00096351 predicted 1119
18 SASI_Rn01_00096352 predicted 1115
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026505 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330403 predicted 731
2 SASI_Mm02_00330404 predicted 732
3 SASI_Mm01_00179813 predicted 1023
4 SASI_Mm02_00330405 predicted 1117
5 SASI_Mm01_00179815 predicted 1113
6 SASI_Mm01_00179818 predicted 476
7 SASI_Mm02_00330406 predicted 710
8 SASI_Mm01_00179819 predicted 1108
9 SASI_Mm01_00179820 predicted 1020
10 SASI_Mm02_00330407 predicted 1107
11 SASI_Mm01_00179811 predicted 1008
12 SASI_Mm01_00179812 predicted 1059
13 SASI_Mm01_00179814 predicted 1001
14 SASI_Mm01_00179816 predicted 1042
15 SASI_Mm01_00179817 predicted 1035
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026505
VALIDATED
BAMBI MISSION shRNA Bacterial Glycerol Stock
BMP and activin membrane-bound inhibitor
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026505.1-3739s1c1
Sequence:CCGGCCCGTAAATCTGGTTTCAATACTCGAGTATTGAAACCAGATTTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-482s1c1
Sequence:CCGGGCAGACATCTGCCGAGCCAAACTCGAGTTTGGCTCGGCAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-999s1c1
Sequence:CCGGGCATGTACAGTGGTCATGGAACTCGAGTTCCATGACCACTGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-871s1c1
Sequence:CCGGGCAAGTTGCAAAGTTGGACTTCTCGAGAAGTCCAACTTTGCAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-751s1c1
Sequence:CCGGGCTGCTCATTATGTTGGCCTTCTCGAGAAGGCCAACATAATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-950s21c1
Sequence:CCGGCGGCAAGCAGAGCTCAGTAATCTCGAGATTACTGAGCTCTGCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-743s21c1
Sequence:CCGGATCTTGGTGCTGCTCATTATGCTCGAGCATAATGAGCAGCACCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-647s21c1
Sequence:CCGGAGCAGAAACCTCATCACTAAGCTCGAGCTTAGTGATGAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-770s21c1
Sequence:CCGGTTGCGAATGCTTCGAAGTGAGCTCGAGCTCACTTCGAAGCATTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-1037s21c1
Sequence:CCGGCAGTCATGTCTGAACTATAAACTCGAGTTTATAGTTCAGACATGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026505
VALIDATED
BAMBI MISSION shRNA shRNA Plasmid DNA
BMP and activin membrane-bound inhibitor
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026505.1-3739s1c1
Sequence:CCGGCCCGTAAATCTGGTTTCAATACTCGAGTATTGAAACCAGATTTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-482s1c1
Sequence:CCGGGCAGACATCTGCCGAGCCAAACTCGAGTTTGGCTCGGCAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-999s1c1
Sequence:CCGGGCATGTACAGTGGTCATGGAACTCGAGTTCCATGACCACTGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-871s1c1
Sequence:CCGGGCAAGTTGCAAAGTTGGACTTCTCGAGAAGTCCAACTTTGCAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-751s1c1
Sequence:CCGGGCTGCTCATTATGTTGGCCTTCTCGAGAAGGCCAACATAATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-950s21c1
Sequence:CCGGCGGCAAGCAGAGCTCAGTAATCTCGAGATTACTGAGCTCTGCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-743s21c1
Sequence:CCGGATCTTGGTGCTGCTCATTATGCTCGAGCATAATGAGCAGCACCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-647s21c1
Sequence:CCGGAGCAGAAACCTCATCACTAAGCTCGAGCTTAGTGATGAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-770s21c1
Sequence:CCGGTTGCGAATGCTTCGAAGTGAGCTCGAGCTCACTTCGAAGCATTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-1037s21c1
Sequence:CCGGCAGTCATGTCTGAACTATAAACTCGAGTTTATAGTTCAGACATGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026505
VALIDATED
BAMBI MISSION shRNA Lentiviral Transduction Particles
BMP and activin membrane-bound inhibitor
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120772    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026505.1-3739s1c1
Sequence:CCGGCCCGTAAATCTGGTTTCAATACTCGAGTATTGAAACCAGATTTACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-482s1c1
Sequence:CCGGGCAGACATCTGCCGAGCCAAACTCGAGTTTGGCTCGGCAGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120775    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-999s1c1
Sequence:CCGGGCATGTACAGTGGTCATGGAACTCGAGTTCCATGACCACTGTACATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120774    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-871s1c1
Sequence:CCGGGCAAGTTGCAAAGTTGGACTTCTCGAGAAGTCCAACTTTGCAACTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120773    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026505.1-751s1c1
Sequence:CCGGGCTGCTCATTATGTTGGCCTTCTCGAGAAGGCCAACATAATGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339155    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-950s21c1
Sequence:CCGGCGGCAAGCAGAGCTCAGTAATCTCGAGATTACTGAGCTCTGCTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-743s21c1
Sequence:CCGGATCTTGGTGCTGCTCATTATGCTCGAGCATAATGAGCAGCACCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-647s21c1
Sequence:CCGGAGCAGAAACCTCATCACTAAGCTCGAGCTTAGTGATGAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339093    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-770s21c1
Sequence:CCGGTTGCGAATGCTTCGAAGTGAGCTCGAGCTCACTTCGAAGCATTCGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_026505.2-1037s21c1
Sequence:CCGGCAGTCATGTCTGAACTATAAACTCGAGTTTATAGTTCAGACATGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012342
VALIDATED
BAMBI MISSION shRNA Bacterial Glycerol Stock
BMP and activin membrane-bound inhibitor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-520s1c1
Sequence:CCGGGCCTGCTTCTCTAGACTTCTTCTCGAGAAGAAGTCTAGAGAAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-1090s1c1
Sequence:CCGGGATAAGATCCTCTCGCTTGTTCTCGAGAACAAGCGAGAGGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-538s1c1
Sequence:CCGGCTTGATCCTCAGAACTCAAATCTCGAGATTTGAGTTCTGAGGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-451s1c1
Sequence:CCGGGAAATTCGATGCTACTGTGATCTCGAGATCACAGTAGCATCGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_012342.2-551s21c1
Sequence:CCGGGCCTGCTTCTCTAGACTTCTTCTCGAGAAGAAGTCTAGAGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012342.2-569s21c1
Sequence:CCGGCTTGATCCTCAGAACTCAAATCTCGAGATTTGAGTTCTGAGGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012342.2-1177s21c1
Sequence:CCGGATTCGTATGACGGAGTCTTATCTCGAGATAAGACTCCGTCATACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012342.2-1121s21c1
Sequence:CCGGGATAAGATCCTCTCGCTTGTTCTCGAGAACAAGCGAGAGGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012342
VALIDATED
BAMBI MISSION shRNA shRNA Plasmid DNA
BMP and activin membrane-bound inhibitor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-520s1c1
Sequence:CCGGGCCTGCTTCTCTAGACTTCTTCTCGAGAAGAAGTCTAGAGAAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-1090s1c1
Sequence:CCGGGATAAGATCCTCTCGCTTGTTCTCGAGAACAAGCGAGAGGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-538s1c1
Sequence:CCGGCTTGATCCTCAGAACTCAAATCTCGAGATTTGAGTTCTGAGGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-451s1c1
Sequence:CCGGGAAATTCGATGCTACTGTGATCTCGAGATCACAGTAGCATCGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_012342.2-551s21c1
Sequence:CCGGGCCTGCTTCTCTAGACTTCTTCTCGAGAAGAAGTCTAGAGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012342.2-569s21c1
Sequence:CCGGCTTGATCCTCAGAACTCAAATCTCGAGATTTGAGTTCTGAGGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012342.2-1177s21c1
Sequence:CCGGATTCGTATGACGGAGTCTTATCTCGAGATAAGACTCCGTCATACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012342.2-1121s21c1
Sequence:CCGGGATAAGATCCTCTCGCTTGTTCTCGAGAACAAGCGAGAGGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012342
VALIDATED
BAMBI MISSION shRNA Lentiviral Transduction Particles
BMP and activin membrane-bound inhibitor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180588    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-520s1c1
Sequence:CCGGGCCTGCTTCTCTAGACTTCTTCTCGAGAAGAAGTCTAGAGAAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-1090s1c1
Sequence:CCGGGATAAGATCCTCTCGCTTGTTCTCGAGAACAAGCGAGAGGATCTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-538s1c1
Sequence:CCGGCTTGATCCTCAGAACTCAAATCTCGAGATTTGAGTTCTGAGGATCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_012342.1-451s1c1
Sequence:CCGGGAAATTCGATGCTACTGTGATCTCGAGATCACAGTAGCATCGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330318    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_012342.2-551s21c1
Sequence:CCGGGCCTGCTTCTCTAGACTTCTTCTCGAGAAGAAGTCTAGAGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012342.2-569s21c1
Sequence:CCGGCTTGATCCTCAGAACTCAAATCTCGAGATTTGAGTTCTGAGGATCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330391    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012342.2-1177s21c1
Sequence:CCGGATTCGTATGACGGAGTCTTATCTCGAGATAAGACTCCGTCATACGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_012342.2-1121s21c1
Sequence:CCGGGATAAGATCCTCTCGCTTGTTCTCGAGAACAAGCGAGAGGATCTTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks