EMAIL THIS PAGE TO A FRIEND

BANF1

barrier to autointegration factor 1

76 Gene Product Result for
Synonyms: BAF BCRP1 D14S1460 NGPS
UniProtKB ID: O75531, O60558, Q6FGG7
Gene ID:
Human(8815) Summary: The protein encoded by this gene was first identified by its ability to protect retroviruses from intramolecular integration and therefore promote intermolecular integration into the host cell genome. The protein forms a homodimer which localizes to both the nucleus and cytoplasm and is specifically associated with chromosomes during mitosis. This protein binds to double stranded DNA in a non-specific manner and also binds to LEM-domain containing proteins of the nuclear envelope. This protein is thought to facilitate nuclear reassembly by binding with both DNA and inner nuclear membrane proteins and thereby recruit chromatin to the nuclear periphery. Alternative splicing results in multiple transcript variants encoding the same protein.[provided by RefSeq, Jan 2009]
Mouse(23825) barrier to autointegration factor 1
Rat(114087) barrier to autointegration factor 1
Zebrafish(334717) barrier to autointegration factor 1
domestic cat(101081080) barrier to autointegration factor 1
cow(785958) barrier to autointegration factor 1
cow(360196) barrier to autointegration factor 1
dog(611961) barrier to autointegration factor 1
chicken(777489) barrier to autointegration factor 1
naked mole-rat(101705921) barrier to autointegration factor 1
domestic guinea pig(100736011) barrier to autointegration factor 1
Goat(100861125) barrier to autointegration factor 1
sheep(101112433) barrier to autointegration factor 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011793 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011793 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011793 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003860 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003860 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003860 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121211 MISSION® esiRNA esiRNA human BANF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003860 Rosetta Predictions human pricing
NM_053631 Rosetta Predictions rat pricing
NM_001038231 Rosetta Predictions mouse pricing
NM_011793 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003860 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00123940 predicted 703
2 SASI_Hs01_00123941 predicted 707
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053631 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064472 predicted 318
2 SASI_Rn01_00064473 predicted 392
3 SASI_Rn01_00064474 predicted 286
4 SASI_Rn01_00064475 predicted 261
5 SASI_Rn01_00064477 predicted 226
6 SASI_Rn01_00064478 predicted 339
7 SASI_Rn01_00064479 predicted 326
8 SASI_Rn01_00064480 predicted 430
9 SASI_Rn02_00266344 predicted 390
10 SASI_Rn01_00064481 predicted 331
11 SASI_Rn01_00064476 predicted 214
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201507 predicted 321
2 SASI_Mm02_00289590 predicted 349
3 SASI_Mm01_00201508 predicted 286
4 SASI_Mm01_00201510 predicted 323
5 SASI_Mm01_00201511 predicted 517
6 SASI_Mm01_00201512 predicted 477
7 SASI_Mm02_00289591 predicted 333
8 SASI_Mm01_00201514 predicted 470
9 SASI_Mm01_00201515 predicted 470
10 SASI_Mm02_00289592 predicted 328
11 SASI_Mm01_00201509 predicted 464
12 SASI_Mm01_00201513 predicted 473
13 SASI_Mm01_00201516 predicted 486
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011793 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00119347 predicted 315
2 SASI_Mm02_00321448 predicted 349
3 SASI_Mm01_00119348 predicted 284
4 SASI_Mm01_00119350 predicted 313
5 SASI_Mm01_00119351 predicted 512
6 SASI_Mm01_00119352 predicted 470
7 SASI_Mm02_00321449 predicted 329
8 SASI_Mm01_00119354 predicted 464
9 SASI_Mm01_00119355 predicted 466
10 SASI_Mm02_00321450 predicted 326
11 SASI_Mm01_00119349 predicted 465
12 SASI_Mm01_00119353 predicted 458
13 SASI_Mm01_00119356 predicted 480
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011793
VALIDATED
BANF1 MISSION shRNA Bacterial Glycerol Stock
barrier to autointegration factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-592s21c1
Sequence:CCGGGCAGTTACCAACTTTCCTGAACTCGAGTTCAGGAAAGTTGGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-170s21c1
Sequence:CCGGATTGGTGACGTCCTGAGCAAGCTCGAGCTTGCTCAGGACGTCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-232s21c1
Sequence:CCGGTGGCCAGTTTCTGGTGCTAAACTCGAGTTTAGCACCAGAAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-212s21c1
Sequence:CCGGGACAAGGCTTATGTGGTCCTTCTCGAGAAGGACCACATAAGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011793.2-259s21c1
Sequence:CCGGTGAAGACCTCTTCCGAGAATGCTCGAGCATTCTCGGAAGAGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-592s1c1
Sequence:CCGGGCAGTTACCAACTTTCCTGAACTCGAGTTCAGGAAAGTTGGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-212s1c1
Sequence:CCGGGACAAGGCTTATGTGGTCCTTCTCGAGAAGGACCACATAAGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011793.2-283s1c1
Sequence:CCGGGAAGGATACATGTGGTGCCAACTCGAGTTGGCACCACATGTATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-232s1c1
Sequence:CCGGTGGCCAGTTTCTGGTGCTAAACTCGAGTTTAGCACCAGAAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-337s1c1
Sequence:CCGGTCGAGAATGGTGTGATGCCTTCTCGAGAAGGCATCACACCATTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011793
VALIDATED
BANF1 MISSION shRNA shRNA Plasmid DNA
barrier to autointegration factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-592s21c1
Sequence:CCGGGCAGTTACCAACTTTCCTGAACTCGAGTTCAGGAAAGTTGGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-170s21c1
Sequence:CCGGATTGGTGACGTCCTGAGCAAGCTCGAGCTTGCTCAGGACGTCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-232s21c1
Sequence:CCGGTGGCCAGTTTCTGGTGCTAAACTCGAGTTTAGCACCAGAAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-212s21c1
Sequence:CCGGGACAAGGCTTATGTGGTCCTTCTCGAGAAGGACCACATAAGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011793.2-259s21c1
Sequence:CCGGTGAAGACCTCTTCCGAGAATGCTCGAGCATTCTCGGAAGAGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-592s1c1
Sequence:CCGGGCAGTTACCAACTTTCCTGAACTCGAGTTCAGGAAAGTTGGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-212s1c1
Sequence:CCGGGACAAGGCTTATGTGGTCCTTCTCGAGAAGGACCACATAAGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011793.2-283s1c1
Sequence:CCGGGAAGGATACATGTGGTGCCAACTCGAGTTGGCACCACATGTATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-232s1c1
Sequence:CCGGTGGCCAGTTTCTGGTGCTAAACTCGAGTTTAGCACCAGAAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-337s1c1
Sequence:CCGGTCGAGAATGGTGTGATGCCTTCTCGAGAAGGCATCACACCATTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011793
VALIDATED
BANF1 MISSION shRNA Lentiviral Transduction Particles
barrier to autointegration factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298386    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-592s21c1
Sequence:CCGGGCAGTTACCAACTTTCCTGAACTCGAGTTCAGGAAAGTTGGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-170s21c1
Sequence:CCGGATTGGTGACGTCCTGAGCAAGCTCGAGCTTGCTCAGGACGTCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-232s21c1
Sequence:CCGGTGGCCAGTTTCTGGTGCTAAACTCGAGTTTAGCACCAGAAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011793.2-212s21c1
Sequence:CCGGGACAAGGCTTATGTGGTCCTTCTCGAGAAGGACCACATAAGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295284    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011793.2-259s21c1
Sequence:CCGGTGAAGACCTCTTCCGAGAATGCTCGAGCATTCTCGGAAGAGGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124954    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-592s1c1
Sequence:CCGGGCAGTTACCAACTTTCCTGAACTCGAGTTCAGGAAAGTTGGTAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124955    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-212s1c1
Sequence:CCGGGACAAGGCTTATGTGGTCCTTCTCGAGAAGGACCACATAAGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011793.2-283s1c1
Sequence:CCGGGAAGGATACATGTGGTGCCAACTCGAGTTGGCACCACATGTATCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-232s1c1
Sequence:CCGGTGGCCAGTTTCTGGTGCTAAACTCGAGTTTAGCACCAGAAACTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011793.2-337s1c1
Sequence:CCGGTCGAGAATGGTGTGATGCCTTCTCGAGAAGGCATCACACCATTCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003860
VALIDATED
BANF1 MISSION shRNA Bacterial Glycerol Stock
barrier to autointegration factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000275211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-649s21c1
Sequence:CCGGCAGTTTCTGGTGCTAAAGAAACTCGAGTTTCTTTAGCACCAGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000275270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-738s21c1
Sequence:CCGGCTTCGGATGCCTTCGAGAGTGCTCGAGCACTCTCGAAGGCATCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-996s21c1
Sequence:CCGGCTGGTGACAGTTACCAGCTTTCTCGAGAAAGCTGGTAACTGTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-625s21c1
Sequence:CCGGGACAAGGCCTATGTTGTCCTTCTCGAGAAGGACAACATAGGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-996s1c1
Sequence:CCGGCTGGTGACAGTTACCAGCTTTCTCGAGAAAGCTGGTAACTGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003860.2-660s1c1
Sequence:CCGGGCTAAAGAAAGATGAAGACCTCTCGAGAGGTCTTCATCTTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-647s1c1
Sequence:CCGGGCCAGTTTCTGGTGCTAAAGACTCGAGTCTTTAGCACCAGAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-625s1c1
Sequence:CCGGGACAAGGCCTATGTTGTCCTTCTCGAGAAGGACAACATAGGCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-649s1c1
Sequence:CCGGCAGTTTCTGGTGCTAAAGAAACTCGAGTTTCTTTAGCACCAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003860
VALIDATED
BANF1 MISSION shRNA shRNA Plasmid DNA
barrier to autointegration factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000275211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-649s21c1
Sequence:CCGGCAGTTTCTGGTGCTAAAGAAACTCGAGTTTCTTTAGCACCAGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000275270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-738s21c1
Sequence:CCGGCTTCGGATGCCTTCGAGAGTGCTCGAGCACTCTCGAAGGCATCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-996s21c1
Sequence:CCGGCTGGTGACAGTTACCAGCTTTCTCGAGAAAGCTGGTAACTGTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-625s21c1
Sequence:CCGGGACAAGGCCTATGTTGTCCTTCTCGAGAAGGACAACATAGGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-996s1c1
Sequence:CCGGCTGGTGACAGTTACCAGCTTTCTCGAGAAAGCTGGTAACTGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003860.2-660s1c1
Sequence:CCGGGCTAAAGAAAGATGAAGACCTCTCGAGAGGTCTTCATCTTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-647s1c1
Sequence:CCGGGCCAGTTTCTGGTGCTAAAGACTCGAGTCTTTAGCACCAGAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-625s1c1
Sequence:CCGGGACAAGGCCTATGTTGTCCTTCTCGAGAAGGACAACATAGGCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-649s1c1
Sequence:CCGGCAGTTTCTGGTGCTAAAGAAACTCGAGTTTCTTTAGCACCAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003860
VALIDATED
BANF1 MISSION shRNA Lentiviral Transduction Particles
barrier to autointegration factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000275211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-649s21c1
Sequence:CCGGCAGTTTCTGGTGCTAAAGAAACTCGAGTTTCTTTAGCACCAGAAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000275270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-738s21c1
Sequence:CCGGCTTCGGATGCCTTCGAGAGTGCTCGAGCACTCTCGAAGGCATCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281960    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-996s21c1
Sequence:CCGGCTGGTGACAGTTACCAGCTTTCTCGAGAAAGCTGGTAACTGTCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003860.2-625s21c1
Sequence:CCGGGACAAGGCCTATGTTGTCCTTCTCGAGAAGGACAACATAGGCCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-996s1c1
Sequence:CCGGCTGGTGACAGTTACCAGCTTTCTCGAGAAAGCTGGTAACTGTCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151201    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003860.2-660s1c1
Sequence:CCGGGCTAAAGAAAGATGAAGACCTCTCGAGAGGTCTTCATCTTTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-647s1c1
Sequence:CCGGGCCAGTTTCTGGTGCTAAAGACTCGAGTCTTTAGCACCAGAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154600    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-625s1c1
Sequence:CCGGGACAAGGCCTATGTTGTCCTTCTCGAGAAGGACAACATAGGCCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003860.2-649s1c1
Sequence:CCGGCAGTTTCTGGTGCTAAAGAAACTCGAGTTTCTTTAGCACCAGAAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks