EMAIL THIS PAGE TO A FRIEND

BANF2

barrier to autointegration factor 2

65 Gene Product Result for
Synonyms: BAF-L BAF2 BAFL C20orf179
UniProtKB ID: Q9H503, D3DW25, F5H3F6, Q7Z4M6
Gene ID:
Mouse(403171) barrier to autointegration factor 2
Rat(296198) barrier to autointegration factor 2
cow(538599) barrier to autointegration factor 2
dog(485755) barrier to autointegration factor 2
domestic cat(101099036) barrier to autointegration factor 2
sheep(101120182) barrier to autointegration factor 2
domestic guinea pig(100729393) barrier to autointegration factor 2
naked mole-rat(101713046) barrier to autointegration factor 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA042635 Anti-BANF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2107334 Anti-BANF2 antibody produced in rabbit affinity isolated antibody human, horse, rabbit, mouse, guinea pig
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178477 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178477 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178477 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_207275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228581 MISSION® esiRNA esiRNA targeting human BANF2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001014977 Rosetta Predictions human pricing
NM_178477 Rosetta Predictions human pricing
XM_215865 Rosetta Predictions rat pricing
NM_001044750 Rosetta Predictions mouse pricing
NM_207275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014977 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134987 predicted 195
2 SASI_Hs01_00134988 predicted 203
3 SASI_Hs01_00134990 predicted 202
4 SASI_Hs01_00134991 predicted 209
5 SASI_Hs01_00134992 predicted 197
6 SASI_Hs01_00134993 predicted 211
7 SASI_Hs01_00134994 predicted 198
8 SASI_Hs01_00134995 predicted 213
9 SASI_Hs01_00134996 predicted 209
10 SASI_Hs02_00306599 predicted 185
11 SASI_Hs01_00134989 predicted 203
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178477 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00214038 predicted 338
2 SASI_Hs01_00214039 predicted 293
3 SASI_Hs01_00214040 predicted 290
4 SASI_Hs01_00214041 predicted 349
5 SASI_Hs01_00214042 predicted 351
6 SASI_Hs01_00214043 predicted 342
7 SASI_Hs01_00214044 predicted 345
8 SASI_Hs01_00214045 predicted 352
9 SASI_Hs01_00214046 predicted 362
10 SASI_Hs01_00214047 predicted 346
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_215865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376274 predicted 209
2 SASI_Rn02_00376275 predicted 208
3 SASI_Rn02_00376276 predicted 206
4 SASI_Rn02_00376277 predicted 208
5 SASI_Rn02_00376278 predicted 208
6 SASI_Rn02_00376279 predicted 211
7 SASI_Rn02_00376280 predicted 199
8 SASI_Rn02_00376281 predicted 237
9 SASI_Rn02_00376282 predicted 117
10 SASI_Rn02_00376283 predicted 126
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001044750 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291434 predicted 205
2 SASI_Mm02_00291435 predicted 169
3 SASI_Mm02_00291436 predicted 195
4 SASI_Mm02_00291437 predicted 157
5 SASI_Mm02_00291438 predicted 236
6 SASI_Mm02_00291439 predicted 234
7 SASI_Mm02_00291440 predicted 165
8 SASI_Mm02_00291441 predicted 152
9 SASI_Mm02_00291442 predicted 228
10 SASI_Mm02_00291443 predicted 308
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00033397 predicted 289
2 SASI_Mm01_00033398 predicted 267
3 SASI_Mm01_00033399 predicted 277
4 SASI_Mm01_00033400 predicted 209
5 SASI_Mm01_00033401 predicted 277
6 SASI_Mm01_00033402 predicted 272
7 SASI_Mm01_00033403 predicted 272
8 SASI_Mm01_00033404 predicted 268
9 SASI_Mm01_00033405 predicted 202
10 SASI_Mm01_00033406 predicted 286
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178477
BANF2 MISSION shRNA Bacterial Glycerol Stock
barrier to autointegration factor 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-260s1c1
Sequence:CCGGGCGATCAATTTGGTCACCAAACTCGAGTTTGGTGACCAAATTGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-276s1c1
Sequence:CCGGCCAAAGGTATCAATAAGGCCTCTCGAGAGGCCTTATTGATACCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-277s1c1
Sequence:CCGGCAAAGGTATCAATAAGGCCTACTCGAGTAGGCCTTATTGATACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-265s1c1
Sequence:CCGGCAATTTGGTCACCAAAGGTATCTCGAGATACCTTTGGTGACCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-357s21c1
Sequence:CCGGGCCATGAGCTCGCGATCAATTCTCGAGAATTGATCGCGAGCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-504s21c1
Sequence:CCGGAGACTTCTCACTGCCTCAAGGCTCGAGCCTTGAGGCAGTGAGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-423s21c1
Sequence:CCGGTCCTTCTGATGCACAAGAATGCTCGAGCATTCTTGTGCATCAGAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-433s21c1
Sequence:CCGGGCACAAGAATGAAGCCGAGTTCTCGAGAACTCGGCTTCATTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178477
BANF2 MISSION shRNA shRNA Plasmid DNA
barrier to autointegration factor 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-260s1c1
Sequence:CCGGGCGATCAATTTGGTCACCAAACTCGAGTTTGGTGACCAAATTGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-276s1c1
Sequence:CCGGCCAAAGGTATCAATAAGGCCTCTCGAGAGGCCTTATTGATACCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-277s1c1
Sequence:CCGGCAAAGGTATCAATAAGGCCTACTCGAGTAGGCCTTATTGATACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-265s1c1
Sequence:CCGGCAATTTGGTCACCAAAGGTATCTCGAGATACCTTTGGTGACCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-357s21c1
Sequence:CCGGGCCATGAGCTCGCGATCAATTCTCGAGAATTGATCGCGAGCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-504s21c1
Sequence:CCGGAGACTTCTCACTGCCTCAAGGCTCGAGCCTTGAGGCAGTGAGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-423s21c1
Sequence:CCGGTCCTTCTGATGCACAAGAATGCTCGAGCATTCTTGTGCATCAGAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-433s21c1
Sequence:CCGGGCACAAGAATGAAGCCGAGTTCTCGAGAACTCGGCTTCATTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178477
BANF2 MISSION shRNA Lentiviral Transduction Particles
barrier to autointegration factor 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-260s1c1
Sequence:CCGGGCGATCAATTTGGTCACCAAACTCGAGTTTGGTGACCAAATTGATCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-276s1c1
Sequence:CCGGCCAAAGGTATCAATAAGGCCTCTCGAGAGGCCTTATTGATACCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-277s1c1
Sequence:CCGGCAAAGGTATCAATAAGGCCTACTCGAGTAGGCCTTATTGATACCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178477.1-265s1c1
Sequence:CCGGCAATTTGGTCACCAAAGGTATCTCGAGATACCTTTGGTGACCAAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-357s21c1
Sequence:CCGGGCCATGAGCTCGCGATCAATTCTCGAGAATTGATCGCGAGCTCATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-504s21c1
Sequence:CCGGAGACTTCTCACTGCCTCAAGGCTCGAGCCTTGAGGCAGTGAGAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415047    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-423s21c1
Sequence:CCGGTCCTTCTGATGCACAAGAATGCTCGAGCATTCTTGTGCATCAGAAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433781    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178477.4-433s21c1
Sequence:CCGGGCACAAGAATGAAGCCGAGTTCTCGAGAACTCGGCTTCATTCTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207275
BANF2 MISSION shRNA Bacterial Glycerol Stock
barrier to autointegration factor 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-284s1c1
Sequence:CCGGGCCATCAATTTGGTCACCAAACTCGAGTTTGGTGACCAAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-346s1c1
Sequence:CCGGGATGCACAAGAATGAAGCAGACTCGAGTCTGCTTCATTCTTGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-273s1c1
Sequence:CCGGGCCGTGAACTTGCCATCAATTCTCGAGAATTGATGGCAAGTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-364s1c1
Sequence:CCGGAGAGTTCCAGAGGTGGATCATCTCGAGATGATCCACCTCTGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-218s1c1
Sequence:CCGGGCCTTTCTCTCTGAACCCATTCTCGAGAATGGGTTCAGAGAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207275
BANF2 MISSION shRNA shRNA Plasmid DNA
barrier to autointegration factor 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-284s1c1
Sequence:CCGGGCCATCAATTTGGTCACCAAACTCGAGTTTGGTGACCAAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-346s1c1
Sequence:CCGGGATGCACAAGAATGAAGCAGACTCGAGTCTGCTTCATTCTTGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-273s1c1
Sequence:CCGGGCCGTGAACTTGCCATCAATTCTCGAGAATTGATGGCAAGTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-364s1c1
Sequence:CCGGAGAGTTCCAGAGGTGGATCATCTCGAGATGATCCACCTCTGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-218s1c1
Sequence:CCGGGCCTTTCTCTCTGAACCCATTCTCGAGAATGGGTTCAGAGAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207275
BANF2 MISSION shRNA Lentiviral Transduction Particles
barrier to autointegration factor 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-284s1c1
Sequence:CCGGGCCATCAATTTGGTCACCAAACTCGAGTTTGGTGACCAAATTGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126593    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-346s1c1
Sequence:CCGGGATGCACAAGAATGAAGCAGACTCGAGTCTGCTTCATTCTTGTGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126590    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-273s1c1
Sequence:CCGGGCCGTGAACTTGCCATCAATTCTCGAGAATTGATGGCAAGTTCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126592    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-364s1c1
Sequence:CCGGAGAGTTCCAGAGGTGGATCATCTCGAGATGATCCACCTCTGGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126591    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_207275.1-218s1c1
Sequence:CCGGGCCTTTCTCTCTGAACCCATTCTCGAGAATGGGTTCAGAGAGAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks