EMAIL THIS PAGE TO A FRIEND

BANK1

B-cell scaffold protein with ankyrin repeats 1

119 Gene Product Result for
Synonyms: BANK
Gene ID:
Human(55024) Summary: The protein encoded by this gene is a B-cell-specific scaffold protein that functions in B-cell receptor-induced calcium mobilization from intracellular stores. This protein can also promote Lyn-mediated tyrosine phosphorylation of inositol 1,4,5-trisphosphate receptors. Polymorphisms in this gene are associated with susceptibility to systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Mouse(242248) B cell scaffold protein with ankyrin repeats 1
Rat(365948) B-cell scaffold protein with ankyrin repeats 1
naked mole-rat(101698344) B-cell scaffold protein with ankyrin repeats 1
domestic guinea pig(100729534) B-cell scaffold protein with ankyrin repeats 1
sheep(101122360) B-cell scaffold protein with ankyrin repeats 1
chicken(422711) B-cell scaffold protein with ankyrin repeats 1
dog(487881) B-cell scaffold protein with ankyrin repeats 1
cow(100299906) B-cell scaffold protein with ankyrin repeats 1
Horse(100067773) B-cell scaffold protein with ankyrin repeats 1
domestic cat(101086142) B-cell scaffold protein with ankyrin repeats 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001033350 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033350 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033350 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017935 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017935 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017935 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083907 Rosetta Predictions human pricing
NM_001127507 Rosetta Predictions human pricing
NM_017935 Rosetta Predictions human pricing
NM_001033350 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083907 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317251 predicted 2194
2 SASI_Hs02_00317252 predicted 956
3 SASI_Hs02_00317253 predicted 1485
4 SASI_Hs02_00317254 predicted 920
5 SASI_Hs02_00317255 predicted 774
6 SASI_Hs02_00317256 predicted 1974
7 SASI_Hs02_00317257 predicted 1103
8 SASI_Hs02_00317258 predicted 2022
9 SASI_Hs02_00317259 predicted 1189
10 SASI_Hs02_00317260 predicted 1472
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127507 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329724 predicted 2034
2 SASI_Hs02_00329725 predicted 783
3 SASI_Hs02_00329726 predicted 1311
4 SASI_Hs02_00329727 predicted 750
5 SASI_Hs02_00329728 predicted 611
6 SASI_Hs02_00329729 predicted 1812
7 SASI_Hs02_00329730 predicted 929
8 SASI_Hs02_00329731 predicted 1849
9 SASI_Hs02_00329732 predicted 1016
10 SASI_Hs02_00329733 predicted 1307
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017935 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177469 predicted 2431
2 SASI_Hs01_00177470 predicted 1186
3 SASI_Hs01_00177471 predicted 1717
4 SASI_Hs01_00177472 predicted 1144
5 SASI_Hs01_00177473 predicted 1002
6 SASI_Hs02_00350939 predicted 2213
7 SASI_Hs02_00350940 predicted 1325
8 SASI_Hs02_00350941 predicted 2244
9 SASI_Hs01_00177475 predicted 1418
10 SASI_Hs01_00177476 predicted 1706
11 SASI_Hs01_00177474 predicted 394
12 SASI_Hs01_00177477 predicted 2388
13 SASI_Hs01_00177478 predicted 2081
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033350 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00186245 predicted 764
2 SASI_Mm02_00288635 predicted 2389
3 SASI_Mm01_00186246 predicted 401
4 SASI_Mm01_00186247 predicted 558
5 SASI_Mm02_00288636 predicted 2345
6 SASI_Mm01_00186248 predicted 1163
7 SASI_Mm02_00288637 predicted 2098
8 SASI_Mm01_00186249 predicted 1057
9 SASI_Mm02_00288638 predicted 2039
10 SASI_Mm01_00186250 predicted 1020
11 SASI_Mm01_00186251 predicted 748
12 SASI_Mm01_00186252 predicted 762
13 SASI_Mm01_00186253 predicted 350
14 SASI_Mm01_00186254 predicted 977
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033350
BANK1 MISSION shRNA Bacterial Glycerol Stock
B-cell scaffold protein with ankyrin repeats 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-760s21c1
Sequence:CCGGATGAACTAATTGGCGAAATTCCTCGAGGAATTTCGCCAATTAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-1049s21c1
Sequence:CCGGCAAGCGTGAGATACCATATTACTCGAGTAATATGGTATCTCACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-469s21c1
Sequence:CCGGCAGATCCTTTCTATCAGTTATCTCGAGATAACTGATAGAAAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.2-1026s1c1
Sequence:CCGGGATAATGTTCTTGCATCTATACTCGAGTATAGATGCAAGAACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033350.2-2597s1c1
Sequence:CCGGGTGTTAGCACCACAATTTATTCTCGAGAATAAATTGTGGTGCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-1026s21c1
Sequence:CCGGGATAATGTTCTTGCATCTATACTCGAGTATAGATGCAAGAACATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033350.2-2787s21c1
Sequence:CCGGACCCAAACTATATAGGTTATTCTCGAGAATAACCTATATAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.1-909s1c1
Sequence:CCGGCCACTGTGATGGAATCATCAACTCGAGTTGATGATTCCATCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.1-782s1c1
Sequence:CCGGGCGAAATTCTAGAGGTTGAATCTCGAGATTCAACCTCTAGAATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.1-238s1c1
Sequence:CCGGGCTCTATACTTGAGAGAAATACTCGAGTATTTCTCTCAAGTATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033350
BANK1 MISSION shRNA shRNA Plasmid DNA
B-cell scaffold protein with ankyrin repeats 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-760s21c1
Sequence:CCGGATGAACTAATTGGCGAAATTCCTCGAGGAATTTCGCCAATTAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-1049s21c1
Sequence:CCGGCAAGCGTGAGATACCATATTACTCGAGTAATATGGTATCTCACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-469s21c1
Sequence:CCGGCAGATCCTTTCTATCAGTTATCTCGAGATAACTGATAGAAAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.2-1026s1c1
Sequence:CCGGGATAATGTTCTTGCATCTATACTCGAGTATAGATGCAAGAACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033350.2-2597s1c1
Sequence:CCGGGTGTTAGCACCACAATTTATTCTCGAGAATAAATTGTGGTGCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-1026s21c1
Sequence:CCGGGATAATGTTCTTGCATCTATACTCGAGTATAGATGCAAGAACATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033350.2-2787s21c1
Sequence:CCGGACCCAAACTATATAGGTTATTCTCGAGAATAACCTATATAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.1-909s1c1
Sequence:CCGGCCACTGTGATGGAATCATCAACTCGAGTTGATGATTCCATCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.1-782s1c1
Sequence:CCGGGCGAAATTCTAGAGGTTGAATCTCGAGATTCAACCTCTAGAATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.1-238s1c1
Sequence:CCGGGCTCTATACTTGAGAGAAATACTCGAGTATTTCTCTCAAGTATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033350
BANK1 MISSION shRNA Lentiviral Transduction Particles
B-cell scaffold protein with ankyrin repeats 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257145    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-760s21c1
Sequence:CCGGATGAACTAATTGGCGAAATTCCTCGAGGAATTTCGCCAATTAGTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242017    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-1049s21c1
Sequence:CCGGCAAGCGTGAGATACCATATTACTCGAGTAATATGGTATCTCACGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242019    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-469s21c1
Sequence:CCGGCAGATCCTTTCTATCAGTTATCTCGAGATAACTGATAGAAAGGATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216469    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.2-1026s1c1
Sequence:CCGGGATAATGTTCTTGCATCTATACTCGAGTATAGATGCAAGAACATTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216309    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001033350.2-2597s1c1
Sequence:CCGGGTGTTAGCACCACAATTTATTCTCGAGAATAAATTGTGGTGCTAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242020    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033350.2-1026s21c1
Sequence:CCGGGATAATGTTCTTGCATCTATACTCGAGTATAGATGCAAGAACATTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242018    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033350.2-2787s21c1
Sequence:CCGGACCCAAACTATATAGGTTATTCTCGAGAATAACCTATATAGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200888    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.1-909s1c1
Sequence:CCGGCCACTGTGATGGAATCATCAACTCGAGTTGATGATTCCATCACAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191812    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.1-782s1c1
Sequence:CCGGGCGAAATTCTAGAGGTTGAATCTCGAGATTCAACCTCTAGAATTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200751    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001033350.1-238s1c1
Sequence:CCGGGCTCTATACTTGAGAGAAATACTCGAGTATTTCTCTCAAGTATAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017935
BANK1 MISSION shRNA Bacterial Glycerol Stock
B-cell scaffold protein with ankyrin repeats 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-1391s1c1
Sequence:CCGGGAAGAGGATATTGCCTCATTTCTCGAGAAATGAGGCAATATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-2303s1c1
Sequence:CCGGCAACTACGAGACTGCATTATTCTCGAGAATAATGCAGTCTCGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-2027s1c1
Sequence:CCGGCCTTACATAGCTCAAGTGTTTCTCGAGAAACACTTGAGCTATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-989s1c1
Sequence:CCGGGCAAAGGCAAAGGAATGCCTACTCGAGTAGGCATTCCTTTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-914s1c1
Sequence:CCGGGCTGGTTCAGTCCATGTCAATCTCGAGATTGACATGGACTGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-569s1c1
Sequence:CCGGCCTGAAGACTACATCTCTGTACTCGAGTACAGAGATGTAGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-2577s1c1
Sequence:CCGGCCTGCTCTCTTTAAAGCGAATCTCGAGATTCGCTTTAAAGAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-2309s1c1
Sequence:CCGGCGAGACTGCATTATTGGGAAACTCGAGTTTCCCAATAATGCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-1712s1c1
Sequence:CCGGGAAAGACCTCACTTCACCTTACTCGAGTAAGGTGAAGTGAGGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-358s1c1
Sequence:CCGGGCTGAACTTAACGTCTTACAACTCGAGTTGTAAGACGTTAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017935.2-3001s1c1
Sequence:CCGGGCAGAAACCTTGTCTTATTTACTCGAGTAAATAAGACAAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017935
BANK1 MISSION shRNA shRNA Plasmid DNA
B-cell scaffold protein with ankyrin repeats 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-1391s1c1
Sequence:CCGGGAAGAGGATATTGCCTCATTTCTCGAGAAATGAGGCAATATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-2303s1c1
Sequence:CCGGCAACTACGAGACTGCATTATTCTCGAGAATAATGCAGTCTCGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-2027s1c1
Sequence:CCGGCCTTACATAGCTCAAGTGTTTCTCGAGAAACACTTGAGCTATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-989s1c1
Sequence:CCGGGCAAAGGCAAAGGAATGCCTACTCGAGTAGGCATTCCTTTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-914s1c1
Sequence:CCGGGCTGGTTCAGTCCATGTCAATCTCGAGATTGACATGGACTGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-569s1c1
Sequence:CCGGCCTGAAGACTACATCTCTGTACTCGAGTACAGAGATGTAGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-2577s1c1
Sequence:CCGGCCTGCTCTCTTTAAAGCGAATCTCGAGATTCGCTTTAAAGAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-2309s1c1
Sequence:CCGGCGAGACTGCATTATTGGGAAACTCGAGTTTCCCAATAATGCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-1712s1c1
Sequence:CCGGGAAAGACCTCACTTCACCTTACTCGAGTAAGGTGAAGTGAGGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-358s1c1
Sequence:CCGGGCTGAACTTAACGTCTTACAACTCGAGTTGTAAGACGTTAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017935.2-3001s1c1
Sequence:CCGGGCAGAAACCTTGTCTTATTTACTCGAGTAAATAAGACAAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017935
BANK1 MISSION shRNA Lentiviral Transduction Particles
B-cell scaffold protein with ankyrin repeats 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-1391s1c1
Sequence:CCGGGAAGAGGATATTGCCTCATTTCTCGAGAAATGAGGCAATATCCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-2303s1c1
Sequence:CCGGCAACTACGAGACTGCATTATTCTCGAGAATAATGCAGTCTCGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143933    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-2027s1c1
Sequence:CCGGCCTTACATAGCTCAAGTGTTTCTCGAGAAACACTTGAGCTATGTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-989s1c1
Sequence:CCGGGCAAAGGCAAAGGAATGCCTACTCGAGTAGGCATTCCTTTGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140814    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-914s1c1
Sequence:CCGGGCTGGTTCAGTCCATGTCAATCTCGAGATTGACATGGACTGAACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142807    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-569s1c1
Sequence:CCGGCCTGAAGACTACATCTCTGTACTCGAGTACAGAGATGTAGTCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142916    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-2577s1c1
Sequence:CCGGCCTGCTCTCTTTAAAGCGAATCTCGAGATTCGCTTTAAAGAGAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142959    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-2309s1c1
Sequence:CCGGCGAGACTGCATTATTGGGAAACTCGAGTTTCCCAATAATGCAGTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143789    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017935.2-1712s1c1
Sequence:CCGGGAAAGACCTCACTTCACCTTACTCGAGTAAGGTGAAGTGAGGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122141    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017935.2-358s1c1
Sequence:CCGGGCTGAACTTAACGTCTTACAACTCGAGTTGTAAGACGTTAAGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121656    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_017935.2-3001s1c1
Sequence:CCGGGCAGAAACCTTGTCTTATTTACTCGAGTAAATAAGACAAGGTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks