EMAIL THIS PAGE TO A FRIEND

BANP

BTG3 associated nuclear protein

105 Gene Product Result for
Synonyms: BEND1 SMAR1 SMARBP1
Gene ID:
Human(54971) Summary: This gene encodes a protein that binds to matrix attachment regions. The protein forms a complex with p53 and negatively regulates p53 transcription, and functions as a tumor suppressor and cell cycle regulator. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(53325) BTG3 associated nuclear protein
Rat(292064) Btg3 associated nuclear protein
Zebrafish(553659) BTG3 associated nuclear protein
chicken(415834) BTG3 associated nuclear protein
cow(513446) BTG3 associated nuclear protein
Horse(100056298) BTG3 associated nuclear protein
domestic cat(101090665) BTG3 associated nuclear protein
dog(479618) BTG3 associated nuclear protein
sheep(101105771) BTG3 associated nuclear protein
Domestic Rabbit(100351971) BTG3 associated nuclear protein
domestic guinea pig(100729400) BTG3 associated nuclear protein
naked mole-rat(101719684) BTG3 associated nuclear protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016812 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016812 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016812 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017869 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017869 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017869 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017869 Rosetta Predictions human pricing
NM_079837 Rosetta Predictions human pricing
NM_001106191 Rosetta Predictions rat pricing
NM_001110100 Rosetta Predictions mouse pricing
NM_016812 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017869 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115569 predicted 952
2 SASI_Hs01_00115570 predicted 271
3 SASI_Hs01_00115574 predicted 531
4 SASI_Hs02_00350798 predicted 935
5 SASI_Hs01_00115575 predicted 646
6 SASI_Hs01_00115576 predicted 1658
7 SASI_Hs02_00350799 predicted 292
8 SASI_Hs02_00350800 predicted 1060
9 SASI_Hs02_00350801 predicted 1657
10 SASI_Hs02_00350802 predicted 256
11 SASI_Hs01_00115571 predicted 812
12 SASI_Hs01_00115572 predicted 337
13 SASI_Hs01_00115573 predicted 385
14 SASI_Hs01_00115577 predicted 419
15 SASI_Hs01_00115578 predicted 546
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_079837 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108348 predicted 955
2 SASI_Hs01_00108349 predicted 271
3 SASI_Hs01_00108353 predicted 527
4 SASI_Hs02_00362201 predicted 933
5 SASI_Hs01_00108354 predicted 647
6 SASI_Hs01_00108355 predicted 1718
7 SASI_Hs02_00362202 predicted 292
8 SASI_Hs02_00362203 predicted 1052
9 SASI_Hs02_00362204 predicted 1722
10 SASI_Hs02_00362205 predicted 259
11 SASI_Hs01_00108350 predicted 818
12 SASI_Hs01_00108351 predicted 331
13 SASI_Hs01_00108352 predicted 388
14 SASI_Hs01_00108356 predicted 416
15 SASI_Hs01_00108357 predicted 553
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106191 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216528 predicted 1661
2 SASI_Rn02_00216529 predicted 365
3 SASI_Rn02_00216530 predicted 517
4 SASI_Rn02_00216531 predicted 1067
5 SASI_Rn02_00216532 predicted 760
6 SASI_Rn02_00216533 predicted 1859
7 SASI_Rn02_00216534 predicted 320
8 SASI_Rn02_00216535 predicted 328
9 SASI_Rn02_00216536 predicted 1554
10 SASI_Rn02_00216537 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110100 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304626 predicted 1685
2 SASI_Mm02_00304627 predicted 1104
3 SASI_Mm02_00304628 predicted 556
4 SASI_Mm02_00304629 predicted 357
5 SASI_Mm02_00304630 predicted 366
6 SASI_Mm02_00304631 predicted 277
7 SASI_Mm02_00304632 predicted 799
8 SASI_Mm02_00304633 predicted 297
9 SASI_Mm02_00304634 predicted 900
10 SASI_Mm02_00304635 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016812 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068253 predicted 1692
2 SASI_Mm01_00068254 predicted 1108
3 SASI_Mm02_00323609 predicted 557
4 SASI_Mm01_00068255 predicted 356
5 SASI_Mm01_00068256 predicted 369
6 SASI_Mm01_00068257 predicted 275
7 SASI_Mm01_00068258 predicted 800
8 SASI_Mm01_00068259 predicted 294
9 SASI_Mm01_00068261 predicted 899
10 SASI_Mm01_00068262 predicted 311
11 SASI_Mm01_00068260 predicted 1289
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016812
BANP MISSION shRNA Bacterial Glycerol Stock
BTG3 associated nuclear protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016812.1-1731s1c1
Sequence:CCGGCTCTCTTGCTTCAGCAAGCAACTCGAGTTGCTTGCTGAAGCAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-1427s1c1
Sequence:CCGGGCCTGCTGGAAATGAAATGATCTCGAGATCATTTCATTTCCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-310s1c1
Sequence:CCGGACTCTATTAACCAGACGATATCTCGAGATATCGTCTGGTTAATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-704s1c1
Sequence:CCGGCGATGAGAATAACCCTGAGATCTCGAGATCTCAGGGTTATTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-320s1c1
Sequence:CCGGCCAGACGATATGTTTGCGGTTCTCGAGAACCGCAAACATATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016812.3-2061s21c1
Sequence:CCGGACAGACAAGAACTACGATATTCTCGAGAATATCGTAGTTCTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-308s21c1
Sequence:CCGGCCAGCGACTAGAGATCAATTGCTCGAGCAATTGATCTCTAGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-358s21c1
Sequence:CCGGACTCTATTAACCAGACGATATCTCGAGATATCGTCTGGTTAATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-1592s21c1
Sequence:CCGGGCCTGCTGGAAATGAAATGATCTCGAGATCATTTCATTTCCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-869s21c1
Sequence:CCGGCGATGAGAATAACCCTGAGATCTCGAGATCTCAGGGTTATTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016812
BANP MISSION shRNA shRNA Plasmid DNA
BTG3 associated nuclear protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016812.1-1731s1c1
Sequence:CCGGCTCTCTTGCTTCAGCAAGCAACTCGAGTTGCTTGCTGAAGCAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-1427s1c1
Sequence:CCGGGCCTGCTGGAAATGAAATGATCTCGAGATCATTTCATTTCCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-310s1c1
Sequence:CCGGACTCTATTAACCAGACGATATCTCGAGATATCGTCTGGTTAATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-704s1c1
Sequence:CCGGCGATGAGAATAACCCTGAGATCTCGAGATCTCAGGGTTATTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-320s1c1
Sequence:CCGGCCAGACGATATGTTTGCGGTTCTCGAGAACCGCAAACATATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016812.3-2061s21c1
Sequence:CCGGACAGACAAGAACTACGATATTCTCGAGAATATCGTAGTTCTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-308s21c1
Sequence:CCGGCCAGCGACTAGAGATCAATTGCTCGAGCAATTGATCTCTAGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-358s21c1
Sequence:CCGGACTCTATTAACCAGACGATATCTCGAGATATCGTCTGGTTAATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-1592s21c1
Sequence:CCGGGCCTGCTGGAAATGAAATGATCTCGAGATCATTTCATTTCCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-869s21c1
Sequence:CCGGCGATGAGAATAACCCTGAGATCTCGAGATCTCAGGGTTATTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016812
BANP MISSION shRNA Lentiviral Transduction Particles
BTG3 associated nuclear protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016812.1-1731s1c1
Sequence:CCGGCTCTCTTGCTTCAGCAAGCAACTCGAGTTGCTTGCTGAAGCAAGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-1427s1c1
Sequence:CCGGGCCTGCTGGAAATGAAATGATCTCGAGATCATTTCATTTCCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-310s1c1
Sequence:CCGGACTCTATTAACCAGACGATATCTCGAGATATCGTCTGGTTAATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-704s1c1
Sequence:CCGGCGATGAGAATAACCCTGAGATCTCGAGATCTCAGGGTTATTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016812.1-320s1c1
Sequence:CCGGCCAGACGATATGTTTGCGGTTCTCGAGAACCGCAAACATATCGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304582    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016812.3-2061s21c1
Sequence:CCGGACAGACAAGAACTACGATATTCTCGAGAATATCGTAGTTCTTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-308s21c1
Sequence:CCGGCCAGCGACTAGAGATCAATTGCTCGAGCAATTGATCTCTAGTCGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301965    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-358s21c1
Sequence:CCGGACTCTATTAACCAGACGATATCTCGAGATATCGTCTGGTTAATAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-1592s21c1
Sequence:CCGGGCCTGCTGGAAATGAAATGATCTCGAGATCATTTCATTTCCAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016812.3-869s21c1
Sequence:CCGGCGATGAGAATAACCCTGAGATCTCGAGATCTCAGGGTTATTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017869
VALIDATED
BANP MISSION shRNA Bacterial Glycerol Stock
BTG3 associated nuclear protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017869.2-533s1c1
Sequence:CCGGGCAGAACACCATTGTGGTGAACTCGAGTTCACCACAATGGTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017869.2-252s1c1
Sequence:CCGGGAAGACGAACCTGCTTTGAAACTCGAGTTTCAAAGCAGGTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017869.2-340s1c1
Sequence:CCGGCAATCTGCTTGCGGTTGGATACTCGAGTATCCAACCGCAAGCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-293s21c1
Sequence:CCGGTTGCCAGGATCCATCTATAAACTCGAGTTTATAGATGGATCCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-381s21c1
Sequence:CCGGGCCCTGGAGGCTACTTGTAAACTCGAGTTTACAAGTAGCCTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017869.3-1831s21c1
Sequence:CCGGGGAAATCAAGAACTATGATATCTCGAGATATCATAGTTCTTGATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-356s21c1
Sequence:CCGGGGATAGCATTGAAGCCAAATTCTCGAGAATTTGGCTTCAATGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-269s21c1
Sequence:CCGGGAAACGCCAGCGACTAGAAATCTCGAGATTTCTAGTCGCTGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017869
VALIDATED
BANP MISSION shRNA shRNA Plasmid DNA
BTG3 associated nuclear protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017869.2-533s1c1
Sequence:CCGGGCAGAACACCATTGTGGTGAACTCGAGTTCACCACAATGGTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017869.2-252s1c1
Sequence:CCGGGAAGACGAACCTGCTTTGAAACTCGAGTTTCAAAGCAGGTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017869.2-340s1c1
Sequence:CCGGCAATCTGCTTGCGGTTGGATACTCGAGTATCCAACCGCAAGCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-293s21c1
Sequence:CCGGTTGCCAGGATCCATCTATAAACTCGAGTTTATAGATGGATCCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-381s21c1
Sequence:CCGGGCCCTGGAGGCTACTTGTAAACTCGAGTTTACAAGTAGCCTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017869.3-1831s21c1
Sequence:CCGGGGAAATCAAGAACTATGATATCTCGAGATATCATAGTTCTTGATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-356s21c1
Sequence:CCGGGGATAGCATTGAAGCCAAATTCTCGAGAATTTGGCTTCAATGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-269s21c1
Sequence:CCGGGAAACGCCAGCGACTAGAAATCTCGAGATTTCTAGTCGCTGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017869
VALIDATED
BANP MISSION shRNA Lentiviral Transduction Particles
BTG3 associated nuclear protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180678    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017869.2-533s1c1
Sequence:CCGGGCAGAACACCATTGTGGTGAACTCGAGTTCACCACAATGGTGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017869.2-252s1c1
Sequence:CCGGGAAGACGAACCTGCTTTGAAACTCGAGTTTCAAAGCAGGTTCGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017869.2-340s1c1
Sequence:CCGGCAATCTGCTTGCGGTTGGATACTCGAGTATCCAACCGCAAGCAGATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-293s21c1
Sequence:CCGGTTGCCAGGATCCATCTATAAACTCGAGTTTATAGATGGATCCTGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-381s21c1
Sequence:CCGGGCCCTGGAGGCTACTTGTAAACTCGAGTTTACAAGTAGCCTCCAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240886    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_017869.3-1831s21c1
Sequence:CCGGGGAAATCAAGAACTATGATATCTCGAGATATCATAGTTCTTGATTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-356s21c1
Sequence:CCGGGGATAGCATTGAAGCCAAATTCTCGAGAATTTGGCTTCAATGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245379    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_017869.3-269s21c1
Sequence:CCGGGAAACGCCAGCGACTAGAAATCTCGAGATTTCTAGTCGCTGGCGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks