EMAIL THIS PAGE TO A FRIEND

BAP1

BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)

67 Gene Product Result for
Synonyms: HUCEP-13 UCHL2
UniProtKB ID: Q92560, A8K993, Q6LEM0, Q7Z5E8
Gene ID:
Human(8314) Summary: This gene belongs to the ubiquitin C-terminal hydrolase subfamily of deubiquitinating enzymes that are involved in the removal of ubiquitin from proteins. The encoded enzyme binds to the breast cancer type 1 susceptibility protein (BRCA1) via the RING finger domain of the latter and acts as a tumor suppressor. In addition, the enzyme may be involved in regulation of transcription, regulation of cell cycle and growth, response to DNA damage and chromatin dynamics. Germline mutations in this gene may be associated with tumor predisposition syndrome (TPDS), which involves increased risk of cancers including malignant mesothelioma, uveal melanoma and cutaneous melanoma. [provided by RefSeq, May 2013]
Mouse(104416) Brca1 associated protein 1
Rat(306257) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Zebrafish(558885) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
cow(100124510) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Horse(100051934) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
domestic cat(101092671) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
dog(484737) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
chicken(415944) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Thale Cress(825291) BON association protein 1
naked mole-rat(101703932) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
domestic guinea pig(100731081) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
sheep(101111666) BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004656 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004656 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004656 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027088 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027088 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027088 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004656 Rosetta Predictions human pricing
NM_001107292 Rosetta Predictions rat pricing
NM_027088 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004656 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105395 predicted 323
2 SASI_Hs01_00105396 predicted 1444
3 SASI_Hs02_00338069 predicted 1489
4 SASI_Hs01_00105397 predicted 793
5 SASI_Hs01_00105400 predicted 834
6 SASI_Hs01_00105401 predicted 487
7 SASI_Hs01_00105402 predicted 305
8 SASI_Hs01_00105403 predicted 1729
9 SASI_Hs01_00105404 predicted 1760
10 SASI_Hs02_00338070 predicted 373
11 SASI_Hs01_00105398 predicted 927
12 SASI_Hs01_00105399 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107292 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227405 predicted 570
2 SASI_Rn02_00227406 predicted 2264
3 SASI_Rn02_00227407 predicted 631
4 SASI_Rn02_00227408 predicted 1796
5 SASI_Rn02_00227409 predicted 997
6 SASI_Rn02_00227410 predicted 1047
7 SASI_Rn02_00227411 predicted 538
8 SASI_Rn02_00227412 predicted 947
9 SASI_Rn02_00227413 predicted 1514
10 SASI_Rn02_00227414 predicted 2697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027088 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331515 predicted 1095
2 SASI_Mm01_00101258 predicted 463
3 SASI_Mm01_00101259 predicted 842
4 SASI_Mm01_00101260 predicted 217
5 SASI_Mm01_00101261 predicted 220
6 SASI_Mm01_00101262 predicted 248
7 SASI_Mm01_00101263 predicted 463
8 SASI_Mm01_00101264 predicted 2350
9 SASI_Mm01_00101265 predicted 686
10 SASI_Mm02_00331516 predicted 735
11 SASI_Mm01_00101256 predicted 800
12 SASI_Mm01_00101257 predicted 1210
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004656
VALIDATED
BAP1 MISSION shRNA Bacterial Glycerol Stock
BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-1735s21c1
Sequence:CCGGTGTTGACTGCATACGCTACAACTCGAGTTGTAGCGTATGCAGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-489s21c1
Sequence:CCGGAGAGCAAAGGATATGCGATTGCTCGAGCAATCGCATATCCTTTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-892s21c1
Sequence:CCGGGCAGCAGCTGATAAGAGTAACCTCGAGGTTACTCTTATCAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-1455s21c1
Sequence:CCGGTCTTGGCTGAGAAGCTCAAAGCTCGAGCTTTGAGCTTCTCAGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004656.2-2383s21c1
Sequence:CCGGTTTCCCAGTATTACTGAATAGCTCGAGCTATTCAGTAATACTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004656.2-2735s21c1
Sequence:CCGGATCATGCCACGGTCCCAACTACTCGAGTAGTTGGGACCGTGGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004656.2-321s1c1
Sequence:CCGGCGTCCGTGATTGATGATGATACTCGAGTATCATCATCAATCACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_004656.2-2119s1c1
Sequence:CCGGCCACAACTACGATGAGTTCATCTCGAGATGAACTCATCGTAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004656.2-238s1c1
Sequence:CCGGCCCTGTATATGGATTTATCTTCTCGAGAAGATAAATCCATATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_004656.2-169s1c1
Sequence:CCGGCGTGGAAGATTTCGGTGTCAACTCGAGTTGACACCGAAATCTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004656
VALIDATED
BAP1 MISSION shRNA shRNA Plasmid DNA
BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-1735s21c1
Sequence:CCGGTGTTGACTGCATACGCTACAACTCGAGTTGTAGCGTATGCAGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-489s21c1
Sequence:CCGGAGAGCAAAGGATATGCGATTGCTCGAGCAATCGCATATCCTTTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-892s21c1
Sequence:CCGGGCAGCAGCTGATAAGAGTAACCTCGAGGTTACTCTTATCAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-1455s21c1
Sequence:CCGGTCTTGGCTGAGAAGCTCAAAGCTCGAGCTTTGAGCTTCTCAGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004656.2-2383s21c1
Sequence:CCGGTTTCCCAGTATTACTGAATAGCTCGAGCTATTCAGTAATACTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004656.2-2735s21c1
Sequence:CCGGATCATGCCACGGTCCCAACTACTCGAGTAGTTGGGACCGTGGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004656.2-321s1c1
Sequence:CCGGCGTCCGTGATTGATGATGATACTCGAGTATCATCATCAATCACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_004656.2-2119s1c1
Sequence:CCGGCCACAACTACGATGAGTTCATCTCGAGATGAACTCATCGTAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004656.2-238s1c1
Sequence:CCGGCCCTGTATATGGATTTATCTTCTCGAGAAGATAAATCCATATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_004656.2-169s1c1
Sequence:CCGGCGTGGAAGATTTCGGTGTCAACTCGAGTTGACACCGAAATCTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004656
VALIDATED
BAP1 MISSION shRNA Lentiviral Transduction Particles
BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-1735s21c1
Sequence:CCGGTGTTGACTGCATACGCTACAACTCGAGTTGTAGCGTATGCAGTCAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-489s21c1
Sequence:CCGGAGAGCAAAGGATATGCGATTGCTCGAGCAATCGCATATCCTTTGCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-892s21c1
Sequence:CCGGGCAGCAGCTGATAAGAGTAACCTCGAGGTTACTCTTATCAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004656.2-1455s21c1
Sequence:CCGGTCTTGGCTGAGAAGCTCAAAGCTCGAGCTTTGAGCTTCTCAGCCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421661    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004656.2-2383s21c1
Sequence:CCGGTTTCCCAGTATTACTGAATAGCTCGAGCTATTCAGTAATACTGGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004656.2-2735s21c1
Sequence:CCGGATCATGCCACGGTCCCAACTACTCGAGTAGTTGGGACCGTGGCATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004656.2-321s1c1
Sequence:CCGGCGTCCGTGATTGATGATGATACTCGAGTATCATCATCAATCACGGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007374    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_004656.2-2119s1c1
Sequence:CCGGCCACAACTACGATGAGTTCATCTCGAGATGAACTCATCGTAGTTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004656.2-238s1c1
Sequence:CCGGCCCTGTATATGGATTTATCTTCTCGAGAAGATAAATCCATATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_004656.2-169s1c1
Sequence:CCGGCGTGGAAGATTTCGGTGTCAACTCGAGTTGACACCGAAATCTTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027088
VALIDATED
BAP1 MISSION shRNA Bacterial Glycerol Stock
BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027088.2-3068s21c1
Sequence:CCGGCCCTCAGTATTACCATGTCTTCTCGAGAAGACATGGTAATACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-2026s21c1
Sequence:CCGGGCACTGCTAAAGTGTGTAGAACTCGAGTTCTACACACTTTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-335s21c1
Sequence:CCGGCGTCTGTGATTGATGATGATACTCGAGTATCATCATCAATCACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-2129s21c1
Sequence:CCGGCCCACAACTATGACGAGTTTACTCGAGTAAACTCGTCATAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-1088s21c1
Sequence:CCGGGCCCACAAACTACAACCCATACTCGAGTATGGGTTGTAGTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027088.1-2971s1c1
Sequence:CCGGCCCTCAGTATTACCATGTCTTCTCGAGAAGACATGGTAATACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027088.1-989s1c1
Sequence:CCGGGCCCACAAACTACAACCCATACTCGAGTATGGGTTGTAGTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027088.1-236s1c1
Sequence:CCGGCGTCTGTGATTGATGATGATACTCGAGTATCATCATCAATCACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027088.1-1927s1c1
Sequence:CCGGGCACTGCTAAAGTGTGTAGAACTCGAGTTCTACACACTTTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000030721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027088.1-2030s1c1
Sequence:CCGGCCCACAACTATGACGAGTTTACTCGAGTAAACTCGTCATAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027088
VALIDATED
BAP1 MISSION shRNA shRNA Plasmid DNA
BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027088.2-3068s21c1
Sequence:CCGGCCCTCAGTATTACCATGTCTTCTCGAGAAGACATGGTAATACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-2026s21c1
Sequence:CCGGGCACTGCTAAAGTGTGTAGAACTCGAGTTCTACACACTTTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-335s21c1
Sequence:CCGGCGTCTGTGATTGATGATGATACTCGAGTATCATCATCAATCACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-2129s21c1
Sequence:CCGGCCCACAACTATGACGAGTTTACTCGAGTAAACTCGTCATAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-1088s21c1
Sequence:CCGGGCCCACAAACTACAACCCATACTCGAGTATGGGTTGTAGTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027088.1-2971s1c1
Sequence:CCGGCCCTCAGTATTACCATGTCTTCTCGAGAAGACATGGTAATACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027088.1-989s1c1
Sequence:CCGGGCCCACAAACTACAACCCATACTCGAGTATGGGTTGTAGTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027088.1-236s1c1
Sequence:CCGGCGTCTGTGATTGATGATGATACTCGAGTATCATCATCAATCACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027088.1-1927s1c1
Sequence:CCGGGCACTGCTAAAGTGTGTAGAACTCGAGTTCTACACACTTTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000030721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027088.1-2030s1c1
Sequence:CCGGCCCACAACTATGACGAGTTTACTCGAGTAAACTCGTCATAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027088
VALIDATED
BAP1 MISSION shRNA Lentiviral Transduction Particles
BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315583    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_027088.2-3068s21c1
Sequence:CCGGCCCTCAGTATTACCATGTCTTCTCGAGAAGACATGGTAATACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-2026s21c1
Sequence:CCGGGCACTGCTAAAGTGTGTAGAACTCGAGTTCTACACACTTTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-335s21c1
Sequence:CCGGCGTCTGTGATTGATGATGATACTCGAGTATCATCATCAATCACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308835    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-2129s21c1
Sequence:CCGGCCCACAACTATGACGAGTTTACTCGAGTAAACTCGTCATAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308833    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027088.2-1088s21c1
Sequence:CCGGGCCCACAAACTACAACCCATACTCGAGTATGGGTTGTAGTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030719    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027088.1-2971s1c1
Sequence:CCGGCCCTCAGTATTACCATGTCTTCTCGAGAAGACATGGTAATACTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027088.1-989s1c1
Sequence:CCGGGCCCACAAACTACAACCCATACTCGAGTATGGGTTGTAGTTTGTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027088.1-236s1c1
Sequence:CCGGCGTCTGTGATTGATGATGATACTCGAGTATCATCATCAATCACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027088.1-1927s1c1
Sequence:CCGGGCACTGCTAAAGTGTGTAGAACTCGAGTTCTACACACTTTAGCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000030721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027088.1-2030s1c1
Sequence:CCGGCCCACAACTATGACGAGTTTACTCGAGTAAACTCGTCATAGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks