EMAIL THIS PAGE TO A FRIEND

BARD1

BRCA1 associated RING domain 1

UniProtKB ID: Q99728, O43574, Q53SS5
Gene ID:
Human(580) Summary: This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. [provided by RefSeq, Jul 2008]
Mouse(12021) BRCA1 associated RING domain 1
Rat(64557) BRCA1 associated RING domain 1
Zebrafish(333951) BRCA1 associated RING domain 1
cow(530961) BRCA1 associated RING domain 1
Horse(100053962) BRCA1 associated RING domain 1
domestic cat(101080728) BRCA1 associated RING domain 1
dog(610190) BRCA1 associated RING domain 1
chicken(424010) BRCA1 associated RING domain 1
Thale Cress(839329) BRCA1-associated RING domain protein 1
sheep(101108373) BRCA1 associated RING domain 1
domestic guinea pig(100731860) BRCA1 associated RING domain 1
naked mole-rat(101722439) BRCA1 associated RING domain 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000465 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000465 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000465 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007525 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007525 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007525 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000465 Rosetta Predictions human pricing
NM_022622 Rosetta Predictions rat pricing
NM_007525 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000465 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222476 predicted 1067
2 SASI_Hs01_00222477 predicted 1891
3 SASI_Hs01_00222478 predicted 1448
4 SASI_Hs01_00222480 predicted 1975
5 SASI_Hs01_00222481 predicted 2276
6 SASI_Hs01_00222482 predicted 1279
7 SASI_Hs01_00222483 predicted 342
8 SASI_Hs02_00302610 predicted 1754
9 SASI_Hs01_00222484 predicted 360
10 SASI_Hs01_00222485 predicted 1573
11 SASI_Hs01_00222479 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022622 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263406 predicted 1888
2 SASI_Rn01_00098688 predicted 1778
3 SASI_Rn01_00098689 predicted 1455
4 SASI_Rn01_00098690 predicted 530
5 SASI_Rn01_00098691 predicted 1549
6 SASI_Rn01_00098692 predicted 2199
7 SASI_Rn01_00098693 predicted 1588
8 SASI_Rn01_00098694 predicted 1301
9 SASI_Rn01_00098695 predicted 348
10 SASI_Rn01_00098696 predicted 662
11 SASI_Rn01_00098697 predicted 436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007525 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063325 predicted 1817
2 SASI_Mm01_00063326 predicted 507
3 SASI_Mm01_00063327 predicted 1074
4 SASI_Mm02_00311836 predicted 1472
5 SASI_Mm01_00063330 predicted 570
6 SASI_Mm01_00063331 predicted 679
7 SASI_Mm02_00311837 predicted 1436
8 SASI_Mm02_00311838 predicted 2519
9 SASI_Mm01_00063332 predicted 914
10 SASI_Mm01_00063333 predicted 1598
11 SASI_Mm01_00063324 predicted 552
12 SASI_Mm01_00063328 predicted 2085
13 SASI_Mm01_00063329 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000465
VALIDATED
BARD1 MISSION shRNA Bacterial Glycerol Stock
BRCA1 associated RING domain 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000003746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000465.x-2500s1c1
Sequence:CCGGAGGTAGAGTCATTCATATTTGCTCGAGCAAATATGAATGACTCTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000465.x-1166s1c1
Sequence:CCGGCCACCTTCATGCAAACGTAAACTCGAGTTTACGTTTGCATGAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000465.x-938s1c1
Sequence:CCGGCCAGACACTAAGAGCAGGAATCTCGAGATTCCTGCTCTTAGTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000003747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000465.x-2083s1c1
Sequence:CCGGGCTGTTTGATGGATGCTACTTCTCGAGAAGTAGCATCCATCAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000465.2-336s21c1
Sequence:CCGGGCACATCTTCTGTAGTAATTGCTCGAGCAATTACTACAGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000465.2-284s21c1
Sequence:CCGGGCTCGCGTTGTACTAACATTCCTCGAGGAATGTTAGTACAACGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-1715s21c1
Sequence:CCGGGTCTGCGGCCTGTCGATTATACTCGAGTATAATCGACAGGCCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-2192s21c1
Sequence:CCGGATCCAAAGGACAACCTTATTACTCGAGTAATAAGGTTGTCCTTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-571s21c1
Sequence:CCGGTGGTTTAGCCCTCGAAGTAAGCTCGAGCTTACTTCGAGGGCTAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000465.2-2270s21c1
Sequence:CCGGACGTGACTCAGACCATCAATACTCGAGTATTGATGGTCTGAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-1743s21c1
Sequence:CCGGTGAAAGTATGAAATCGCTATTCTCGAGAATAGCGATTTCATACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000465
VALIDATED
BARD1 MISSION shRNA shRNA Plasmid DNA
BRCA1 associated RING domain 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000003746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000465.x-2500s1c1
Sequence:CCGGAGGTAGAGTCATTCATATTTGCTCGAGCAAATATGAATGACTCTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000465.x-1166s1c1
Sequence:CCGGCCACCTTCATGCAAACGTAAACTCGAGTTTACGTTTGCATGAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000465.x-938s1c1
Sequence:CCGGCCAGACACTAAGAGCAGGAATCTCGAGATTCCTGCTCTTAGTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000003747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000465.x-2083s1c1
Sequence:CCGGGCTGTTTGATGGATGCTACTTCTCGAGAAGTAGCATCCATCAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000465.2-336s21c1
Sequence:CCGGGCACATCTTCTGTAGTAATTGCTCGAGCAATTACTACAGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000465.2-284s21c1
Sequence:CCGGGCTCGCGTTGTACTAACATTCCTCGAGGAATGTTAGTACAACGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-1715s21c1
Sequence:CCGGGTCTGCGGCCTGTCGATTATACTCGAGTATAATCGACAGGCCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-2192s21c1
Sequence:CCGGATCCAAAGGACAACCTTATTACTCGAGTAATAAGGTTGTCCTTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-571s21c1
Sequence:CCGGTGGTTTAGCCCTCGAAGTAAGCTCGAGCTTACTTCGAGGGCTAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000465.2-2270s21c1
Sequence:CCGGACGTGACTCAGACCATCAATACTCGAGTATTGATGGTCTGAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-1743s21c1
Sequence:CCGGTGAAAGTATGAAATCGCTATTCTCGAGAATAGCGATTTCATACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000465
VALIDATED
BARD1 MISSION shRNA Lentiviral Transduction Particles
BRCA1 associated RING domain 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000003746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000465.x-2500s1c1
Sequence:CCGGAGGTAGAGTCATTCATATTTGCTCGAGCAAATATGAATGACTCTACCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000465.x-1166s1c1
Sequence:CCGGCCACCTTCATGCAAACGTAAACTCGAGTTTACGTTTGCATGAAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000465.x-938s1c1
Sequence:CCGGCCAGACACTAAGAGCAGGAATCTCGAGATTCCTGCTCTTAGTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000003747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_000465.x-2083s1c1
Sequence:CCGGGCTGTTTGATGGATGCTACTTCTCGAGAAGTAGCATCCATCAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000465.2-336s21c1
Sequence:CCGGGCACATCTTCTGTAGTAATTGCTCGAGCAATTACTACAGAAGATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000465.2-284s21c1
Sequence:CCGGGCTCGCGTTGTACTAACATTCCTCGAGGAATGTTAGTACAACGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350414    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-1715s21c1
Sequence:CCGGGTCTGCGGCCTGTCGATTATACTCGAGTATAATCGACAGGCCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-2192s21c1
Sequence:CCGGATCCAAAGGACAACCTTATTACTCGAGTAATAAGGTTGTCCTTTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-571s21c1
Sequence:CCGGTGGTTTAGCCCTCGAAGTAAGCTCGAGCTTACTTCGAGGGCTAAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000465.2-2270s21c1
Sequence:CCGGACGTGACTCAGACCATCAATACTCGAGTATTGATGGTCTGAGTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_000465.2-1743s21c1
Sequence:CCGGTGAAAGTATGAAATCGCTATTCTCGAGAATAGCGATTTCATACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007525
VALIDATED
BARD1 MISSION shRNA Bacterial Glycerol Stock
BRCA1 associated RING domain 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007525.1-1663s1c1
Sequence:CCGGCCTGTGGACTATACAGACAATCTCGAGATTGTCTGTATAGTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007525.1-844s1c1
Sequence:CCGGCCACGGGTAAATGGTGAAATACTCGAGTATTTCACCATTTACCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007525.1-535s1c1
Sequence:CCGGCGAAGTAAGAAGGTTAGATATCTCGAGATATCTAACCTTCTTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007525.1-1378s1c1
Sequence:CCGGGCTTCTATTAAGGGTGATATACTCGAGTATATCACCCTTAATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-1687s21c1
Sequence:CCGGAGGAATGCTGTTAACATATTTCTCGAGAAATATGTTAACAGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007525.3-2867s21c1
Sequence:CCGGGTTAAATCCACGTGGTGTATTCTCGAGAATACACCACGTGGATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-811s21c1
Sequence:CCGGGAAACAAAGGATAGTAGATTTCTCGAGAAATCTACTATCCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-2339s21c1
Sequence:CCGGTCGTCTACGAAGACCTGTTTACTCGAGTAAACAGGTCTTCGTAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-712s21c1
Sequence:CCGGGCTGTTCCTAAGAGTGCTAAACTCGAGTTTAGCACTCTTAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007525.3-2513s21c1
Sequence:CCGGACAACGGCCATTGTGATATTTCTCGAGAAATATCACAATGGCCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007525
VALIDATED
BARD1 MISSION shRNA shRNA Plasmid DNA
BRCA1 associated RING domain 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007525.1-1663s1c1
Sequence:CCGGCCTGTGGACTATACAGACAATCTCGAGATTGTCTGTATAGTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007525.1-844s1c1
Sequence:CCGGCCACGGGTAAATGGTGAAATACTCGAGTATTTCACCATTTACCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007525.1-535s1c1
Sequence:CCGGCGAAGTAAGAAGGTTAGATATCTCGAGATATCTAACCTTCTTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007525.1-1378s1c1
Sequence:CCGGGCTTCTATTAAGGGTGATATACTCGAGTATATCACCCTTAATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-1687s21c1
Sequence:CCGGAGGAATGCTGTTAACATATTTCTCGAGAAATATGTTAACAGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007525.3-2867s21c1
Sequence:CCGGGTTAAATCCACGTGGTGTATTCTCGAGAATACACCACGTGGATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-811s21c1
Sequence:CCGGGAAACAAAGGATAGTAGATTTCTCGAGAAATCTACTATCCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-2339s21c1
Sequence:CCGGTCGTCTACGAAGACCTGTTTACTCGAGTAAACAGGTCTTCGTAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-712s21c1
Sequence:CCGGGCTGTTCCTAAGAGTGCTAAACTCGAGTTTAGCACTCTTAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007525.3-2513s21c1
Sequence:CCGGACAACGGCCATTGTGATATTTCTCGAGAAATATCACAATGGCCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007525
VALIDATED
BARD1 MISSION shRNA Lentiviral Transduction Particles
BRCA1 associated RING domain 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084436    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007525.1-1663s1c1
Sequence:CCGGCCTGTGGACTATACAGACAATCTCGAGATTGTCTGTATAGTCCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084435    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007525.1-844s1c1
Sequence:CCGGCCACGGGTAAATGGTGAAATACTCGAGTATTTCACCATTTACCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007525.1-535s1c1
Sequence:CCGGCGAAGTAAGAAGGTTAGATATCTCGAGATATCTAACCTTCTTACTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084433    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007525.1-1378s1c1
Sequence:CCGGGCTTCTATTAAGGGTGATATACTCGAGTATATCACCCTTAATAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435013    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-1687s21c1
Sequence:CCGGAGGAATGCTGTTAACATATTTCTCGAGAAATATGTTAACAGCATTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434083    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007525.3-2867s21c1
Sequence:CCGGGTTAAATCCACGTGGTGTATTCTCGAGAATACACCACGTGGATTTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-811s21c1
Sequence:CCGGGAAACAAAGGATAGTAGATTTCTCGAGAAATCTACTATCCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-2339s21c1
Sequence:CCGGTCGTCTACGAAGACCTGTTTACTCGAGTAAACAGGTCTTCGTAGACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419208    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007525.3-712s21c1
Sequence:CCGGGCTGTTCCTAAGAGTGCTAAACTCGAGTTTAGCACTCTTAGGAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422993    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007525.3-2513s21c1
Sequence:CCGGACAACGGCCATTGTGATATTTCTCGAGAAATATCACAATGGCCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks