EMAIL THIS PAGE TO A FRIEND

BARHL1

BarH-like homeobox 1

50 Gene Product Result for
UniProtKB ID: Q9BZE3, Q5T6V2, Q9NY88
Gene ID:
Mouse(54422) BarH-like 1 (Drosophila)
Rat(117232) BarH-like homeobox 1
naked mole-rat(101710801) BarH-like homeobox 1
domestic guinea pig(100717655) BarH-like homeobox 1
sheep(101119896) BarH-like homeobox 1
chicken(429598) BarH-like homeobox 1
dog(491283) BarH-like homeobox 1
domestic cat(101089473) BarH-like homeobox 1
cow(615585) BarH-like homeobox 1
Horse(100066657) BarH-like homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019446 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019446 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019446 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020064 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020064 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020064 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020064 Rosetta Predictions human pricing
NM_057109 Rosetta Predictions rat pricing
NM_019446 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00105385 predicted 469
2 SASI_Hs01_00105387 predicted 1545
3 SASI_Hs01_00105388 predicted 964
4 SASI_Hs01_00105389 predicted 485
5 SASI_Hs01_00105390 predicted 634
6 SASI_Hs01_00105391 predicted 947
7 SASI_Hs01_00105392 predicted 1664
8 SASI_Hs01_00105393 predicted 894
9 SASI_Hs01_00105394 predicted 1674
10 SASI_Hs02_00352951 predicted 630
11 SASI_Hs01_00105386 predicted 1667
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057109 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113148 predicted 1516
2 SASI_Rn01_00113149 predicted 1530
3 SASI_Rn02_00267044 predicted 1429
4 SASI_Rn01_00113150 predicted 2093
5 SASI_Rn01_00113151 predicted 1922
6 SASI_Rn02_00267045 predicted 2162
7 SASI_Rn01_00113152 predicted 1441
8 SASI_Rn01_00113153 predicted 2155
9 SASI_Rn01_00113154 predicted 1365
10 SASI_Rn01_00113156 predicted 2040
11 SASI_Rn01_00113155 predicted 929
12 SASI_Rn01_00113157 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019446 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026837 predicted 2191
2 SASI_Mm01_00026838 predicted 1045
3 SASI_Mm01_00026839 predicted 2160
4 SASI_Mm01_00026840 predicted 1430
5 SASI_Mm01_00026841 predicted 1379
6 SASI_Mm01_00026842 predicted 2209
7 SASI_Mm01_00026843 predicted 1202
8 SASI_Mm01_00026844 predicted 1336
9 SASI_Mm01_00026845 predicted 2183
10 SASI_Mm01_00026846 predicted 1445
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019446
BARHL1 MISSION shRNA Bacterial Glycerol Stock
BarH-like homeobox 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000085578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019446.2-3405s1c1
Sequence:CCGGCCCTCGGCTTTCAAGTTCTTTCTCGAGAAAGAACTTGAAAGCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1198s1c1
Sequence:CCGGCGCTTCATCAGACTCTGAGTACTCGAGTACTCAGAGTCTGATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1039s1c1
Sequence:CCGGCTCCTTTCTGATCAGGGACATCTCGAGATGTCCCTGATCAGAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1355s1c1
Sequence:CCGGCAGAAATACCTGAGCGTGCAACTCGAGTTGCACGCTCAGGTATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000085580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1207s1c1
Sequence:CCGGAGACTCTGAGTACAAAGTGAACTCGAGTTCACTTTGTACTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019446
BARHL1 MISSION shRNA shRNA Plasmid DNA
BarH-like homeobox 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000085578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019446.2-3405s1c1
Sequence:CCGGCCCTCGGCTTTCAAGTTCTTTCTCGAGAAAGAACTTGAAAGCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1198s1c1
Sequence:CCGGCGCTTCATCAGACTCTGAGTACTCGAGTACTCAGAGTCTGATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1039s1c1
Sequence:CCGGCTCCTTTCTGATCAGGGACATCTCGAGATGTCCCTGATCAGAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1355s1c1
Sequence:CCGGCAGAAATACCTGAGCGTGCAACTCGAGTTGCACGCTCAGGTATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000085580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1207s1c1
Sequence:CCGGAGACTCTGAGTACAAAGTGAACTCGAGTTCACTTTGTACTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019446
BARHL1 MISSION shRNA Lentiviral Transduction Particles
BarH-like homeobox 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000085578    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019446.2-3405s1c1
Sequence:CCGGCCCTCGGCTTTCAAGTTCTTTCTCGAGAAAGAACTTGAAAGCCGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1198s1c1
Sequence:CCGGCGCTTCATCAGACTCTGAGTACTCGAGTACTCAGAGTCTGATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1039s1c1
Sequence:CCGGCTCCTTTCTGATCAGGGACATCTCGAGATGTCCCTGATCAGAAAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1355s1c1
Sequence:CCGGCAGAAATACCTGAGCGTGCAACTCGAGTTGCACGCTCAGGTATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000085580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019446.2-1207s1c1
Sequence:CCGGAGACTCTGAGTACAAAGTGAACTCGAGTTCACTTTGTACTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020064
BARHL1 MISSION shRNA Bacterial Glycerol Stock
BarH-like homeobox 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000016628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-970s1c1
Sequence:CCGGCCTTATTTCTACCCGCAGAGTCTCGAGACTCTGCGGGTAGAAATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-879s1c1
Sequence:CCGGCAGGACTAAATGGAAGCGACACTCGAGTGTCGCTTCCATTTAGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-490s1c1
Sequence:CCGGGACATCCTTGCCGACTGCAAACTCGAGTTTGCAGTCGGCAAGGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-348s1c1
Sequence:CCGGCTCTCCAGGAAGGGACTGTTTCTCGAGAAACAGTCCCTTCCTGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020064
BARHL1 MISSION shRNA shRNA Plasmid DNA
BarH-like homeobox 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000016628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-970s1c1
Sequence:CCGGCCTTATTTCTACCCGCAGAGTCTCGAGACTCTGCGGGTAGAAATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-879s1c1
Sequence:CCGGCAGGACTAAATGGAAGCGACACTCGAGTGTCGCTTCCATTTAGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-490s1c1
Sequence:CCGGGACATCCTTGCCGACTGCAAACTCGAGTTTGCAGTCGGCAAGGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-348s1c1
Sequence:CCGGCTCTCCAGGAAGGGACTGTTTCTCGAGAAACAGTCCCTTCCTGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020064
BARHL1 MISSION shRNA Lentiviral Transduction Particles
BarH-like homeobox 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000016628    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-970s1c1
Sequence:CCGGCCTTATTTCTACCCGCAGAGTCTCGAGACTCTGCGGGTAGAAATAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-879s1c1
Sequence:CCGGCAGGACTAAATGGAAGCGACACTCGAGTGTCGCTTCCATTTAGTCCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-490s1c1
Sequence:CCGGGACATCCTTGCCGACTGCAAACTCGAGTTTGCAGTCGGCAAGGATGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016631    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020064.2-348s1c1
Sequence:CCGGCTCTCCAGGAAGGGACTGTTTCTCGAGAAACAGTCCCTTCCTGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks