EMAIL THIS PAGE TO A FRIEND

BARHL2

BarH-like homeobox 2

56 Gene Product Result for
UniProtKB ID: Q9NY43, A0AVP2, Q7Z4N7
Gene ID:
Mouse(104382) BarH-like 2 (Drosophila)
Rat(65050) BarH-like homeobox 2
Zebrafish(100001699) BarH-like 2
cow(539708) BarH-like homeobox 2
domestic cat(101095428) BarH-like homeobox 2
dog(611092) BarH-like homeobox 2
sheep(101115337) BarH-like homeobox 2
domestic guinea pig(100716039) BarH-like homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV31981 Anti-BARHL2 antibody produced in rabbit affinity isolated antibody bovine, zebrafish, rat, canine, horse, human, guinea pig, mouse, rabbit
immunohistochemistry, western blot pricing
SAB2100203 Anti-BARHL2 antibody produced in rabbit affinity isolated antibody , rat, bovine, mouse, rabbit, canine, zebrafish, human, guinea pig, horse
western blot pricing
HPA028176 Anti-BARHL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB2103248 Anti-BARHL2 antibody produced in rabbit affinity isolated antibody , mouse, rat, zebrafish, rabbit, bovine, human, canine, guinea pig, horse
western blot pricing
HPA031326 Anti-BARHL2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020063 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020063 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020063 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005477 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005477 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005477 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020063 Rosetta Predictions human pricing
NM_022956 Rosetta Predictions rat pricing
NM_001005477 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020063 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069904 predicted 648
2 SASI_Hs01_00069905 predicted 845
3 SASI_Hs01_00069906 predicted 1154
4 SASI_Hs01_00069907 predicted 965
5 SASI_Hs01_00069908 predicted 669
6 SASI_Hs01_00069909 predicted 767
7 SASI_Hs01_00069910 predicted 960
8 SASI_Hs01_00069911 predicted 653
9 SASI_Hs01_00069912 predicted 681
10 SASI_Hs01_00069913 predicted 972
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022956 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00077535 predicted 1173
2 SASI_Rn01_00077536 predicted 791
3 SASI_Rn01_00077537 predicted 543
4 SASI_Rn01_00077539 predicted 673
5 SASI_Rn01_00077540 predicted 598
6 SASI_Rn01_00077542 predicted 862
7 SASI_Rn01_00077543 predicted 246
8 SASI_Rn02_00263691 predicted 1081
9 SASI_Rn01_00077544 predicted 220
10 SASI_Rn02_00263692 predicted 533
11 SASI_Rn01_00077538 predicted 991
12 SASI_Rn01_00077541 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005477 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071645 predicted 793
2 SASI_Mm01_00071646 predicted 1316
3 SASI_Mm01_00071647 predicted 428
4 SASI_Mm01_00071648 predicted 848
5 SASI_Mm01_00071649 predicted 1038
6 SASI_Mm01_00071650 predicted 926
7 SASI_Mm01_00071651 predicted 1171
8 SASI_Mm01_00071652 predicted 1331
9 SASI_Mm01_00071653 predicted 497
10 SASI_Mm01_00071654 predicted 1082
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020063
BARHL2 MISSION shRNA Bacterial Glycerol Stock
BarH-like homeobox 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-980s1c1
Sequence:CCGGCGCCTTATTTCTATCACCCAACTCGAGTTGGGTGATAGAAATAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-196s1c1
Sequence:CCGGTGTTCGGAGATTGATACCGTACTCGAGTACGGTATCAATCTCCGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-770s1c1
Sequence:CCGGAGCTCAATCAACTGGAGCGTACTCGAGTACGCTCCAGTTGATTGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-612s1c1
Sequence:CCGGCAGCAAGACCAAACTCGACAACTCGAGTTGTCGAGTTTGGTCTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-223s21c1
Sequence:CCGGGCGCCTTCTTCTCCTATCTCACTCGAGTGAGATAGGAGAAGAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-641s21c1
Sequence:CCGGATTCCCAGAGCGACATCAAATCTCGAGATTTGATGTCGCTCTGGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-478s21c1
Sequence:CCGGGACATCTTGGGCGACAGCAAACTCGAGTTTGCTGTCGCCCAAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-677s21c1
Sequence:CCGGAGGAAGGAGACCGGGAGATTACTCGAGTAATCTCCCGGTCTCCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020063
BARHL2 MISSION shRNA shRNA Plasmid DNA
BarH-like homeobox 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-980s1c1
Sequence:CCGGCGCCTTATTTCTATCACCCAACTCGAGTTGGGTGATAGAAATAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-196s1c1
Sequence:CCGGTGTTCGGAGATTGATACCGTACTCGAGTACGGTATCAATCTCCGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-770s1c1
Sequence:CCGGAGCTCAATCAACTGGAGCGTACTCGAGTACGCTCCAGTTGATTGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-612s1c1
Sequence:CCGGCAGCAAGACCAAACTCGACAACTCGAGTTGTCGAGTTTGGTCTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-223s21c1
Sequence:CCGGGCGCCTTCTTCTCCTATCTCACTCGAGTGAGATAGGAGAAGAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-641s21c1
Sequence:CCGGATTCCCAGAGCGACATCAAATCTCGAGATTTGATGTCGCTCTGGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-478s21c1
Sequence:CCGGGACATCTTGGGCGACAGCAAACTCGAGTTTGCTGTCGCCCAAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-677s21c1
Sequence:CCGGAGGAAGGAGACCGGGAGATTACTCGAGTAATCTCCCGGTCTCCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020063
BARHL2 MISSION shRNA Lentiviral Transduction Particles
BarH-like homeobox 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-980s1c1
Sequence:CCGGCGCCTTATTTCTATCACCCAACTCGAGTTGGGTGATAGAAATAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-196s1c1
Sequence:CCGGTGTTCGGAGATTGATACCGTACTCGAGTACGGTATCAATCTCCGAACATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-770s1c1
Sequence:CCGGAGCTCAATCAACTGGAGCGTACTCGAGTACGCTCCAGTTGATTGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020063.1-612s1c1
Sequence:CCGGCAGCAAGACCAAACTCGACAACTCGAGTTGTCGAGTTTGGTCTTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-223s21c1
Sequence:CCGGGCGCCTTCTTCTCCTATCTCACTCGAGTGAGATAGGAGAAGAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428773    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-641s21c1
Sequence:CCGGATTCCCAGAGCGACATCAAATCTCGAGATTTGATGTCGCTCTGGGAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412834    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-478s21c1
Sequence:CCGGGACATCTTGGGCGACAGCAAACTCGAGTTTGCTGTCGCCCAAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020063.1-677s21c1
Sequence:CCGGAGGAAGGAGACCGGGAGATTACTCGAGTAATCTCCCGGTCTCCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005477
BARHL2 MISSION shRNA Bacterial Glycerol Stock
BarH-like homeobox 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005477.1-1558s1c1
Sequence:CCGGCGCACCAAACCAACTGGAATACTCGAGTATTCCAGTTGGTTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-429s1c1
Sequence:CCGGCGCTCGGTGAAGCGAGGACAACTCGAGTTGTCCTCGCTTCACCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-486s1c1
Sequence:CCGGCGGAGATTGATACCGTGGGAACTCGAGTTCCCACGGTATCAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-997s1c1
Sequence:CCGGGAGAGCCAAGAAACCTCGAAACTCGAGTTTCGAGGTTTCTTGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-630s1c1
Sequence:CCGGCCGCGCAAAGTTTGCAGCCTTCTCGAGAAGGCTGCAAACTTTGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005477.1-2135s21c1
Sequence:CCGGGCGATGAGTGATATATCATATCTCGAGATATGATATATCACTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-951s21c1
Sequence:CCGGAGGAAGGAGACCGGGAGATTACTCGAGTAATCTCCCGGTCTCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-929s21c1
Sequence:CCGGATCAAATGCCACGGAACAAAGCTCGAGCTTTGTTCCGTGGCATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-478s21c1
Sequence:CCGGACCCTGTTCGGAGATTGATACCTCGAGGTATCAATCTCCGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-436s21c1
Sequence:CCGGTGAAGCGAGGACAACGGATTTCTCGAGAAATCCGTTGTCCTCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005477
BARHL2 MISSION shRNA shRNA Plasmid DNA
BarH-like homeobox 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005477.1-1558s1c1
Sequence:CCGGCGCACCAAACCAACTGGAATACTCGAGTATTCCAGTTGGTTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-429s1c1
Sequence:CCGGCGCTCGGTGAAGCGAGGACAACTCGAGTTGTCCTCGCTTCACCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-486s1c1
Sequence:CCGGCGGAGATTGATACCGTGGGAACTCGAGTTCCCACGGTATCAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-997s1c1
Sequence:CCGGGAGAGCCAAGAAACCTCGAAACTCGAGTTTCGAGGTTTCTTGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-630s1c1
Sequence:CCGGCCGCGCAAAGTTTGCAGCCTTCTCGAGAAGGCTGCAAACTTTGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005477.1-2135s21c1
Sequence:CCGGGCGATGAGTGATATATCATATCTCGAGATATGATATATCACTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-951s21c1
Sequence:CCGGAGGAAGGAGACCGGGAGATTACTCGAGTAATCTCCCGGTCTCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-929s21c1
Sequence:CCGGATCAAATGCCACGGAACAAAGCTCGAGCTTTGTTCCGTGGCATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-478s21c1
Sequence:CCGGACCCTGTTCGGAGATTGATACCTCGAGGTATCAATCTCCGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-436s21c1
Sequence:CCGGTGAAGCGAGGACAACGGATTTCTCGAGAAATCCGTTGTCCTCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005477
BARHL2 MISSION shRNA Lentiviral Transduction Particles
BarH-like homeobox 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095374    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005477.1-1558s1c1
Sequence:CCGGCGCACCAAACCAACTGGAATACTCGAGTATTCCAGTTGGTTTGGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095378    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-429s1c1
Sequence:CCGGCGCTCGGTGAAGCGAGGACAACTCGAGTTGTCCTCGCTTCACCGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095377    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-486s1c1
Sequence:CCGGCGGAGATTGATACCGTGGGAACTCGAGTTCCCACGGTATCAATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-997s1c1
Sequence:CCGGGAGAGCCAAGAAACCTCGAAACTCGAGTTTCGAGGTTTCTTGGCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005477.1-630s1c1
Sequence:CCGGCCGCGCAAAGTTTGCAGCCTTCTCGAGAAGGCTGCAAACTTTGCGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231200    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005477.1-2135s21c1
Sequence:CCGGGCGATGAGTGATATATCATATCTCGAGATATGATATATCACTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231199    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-951s21c1
Sequence:CCGGAGGAAGGAGACCGGGAGATTACTCGAGTAATCTCCCGGTCTCCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231198    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-929s21c1
Sequence:CCGGATCAAATGCCACGGAACAAAGCTCGAGCTTTGTTCCGTGGCATTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231197    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-478s21c1
Sequence:CCGGACCCTGTTCGGAGATTGATACCTCGAGGTATCAATCTCCGAACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231196    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005477.1-436s21c1
Sequence:CCGGTGAAGCGAGGACAACGGATTTCTCGAGAAATCCGTTGTCCTCGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks