EMAIL THIS PAGE TO A FRIEND

BARX1

BARX homeobox 1

70 Gene Product Result for
UniProtKB ID: Q9HBU1, Q6P2R4, Q96GH8
Gene ID:
Human(56033) Summary: This gene encodes a member of the Bar subclass of homeobox transcription factors. Studies of the mouse and chick homolog suggest the encoded protein may play a role in developing teeth and craniofacial mesenchyme of neural crest origin. The protein may also be associated with differentiation of stomach epithelia. [provided by RefSeq, Jul 2008]
Mouse(12022) BarH-like homeobox 1
Rat(364680) BARX homeobox 1
Zebrafish(553644) BarH-like homeobox 1
dog(610486) BARX homeobox 1
cow(539422) BARX homeobox 1
domestic cat(101093402) BARX homeobox 1
chicken(374017) BARX homeobox 1
naked mole-rat(101721363) BARX homeobox 1
sheep(101110572) BARX homeobox 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007526 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007526 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007526 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021570 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021570 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021570 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021570 Rosetta Predictions human pricing
NM_001108880 Rosetta Predictions rat pricing
NM_007526 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021570 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00354930 predicted 1179
2 SASI_Hs01_00118557 predicted 737
3 SASI_Hs02_00354931 predicted 1037
4 SASI_Hs01_00118558 predicted 1021
5 SASI_Hs02_00354932 predicted 1145
6 SASI_Hs01_00118559 predicted 657
7 SASI_Hs01_00118560 predicted 650
8 SASI_Hs01_00118561 predicted 687
9 SASI_Hs01_00118562 predicted 849
10 SASI_Hs01_00118563 predicted 672
11 SASI_Hs01_00118556 predicted 667
12 SASI_Hs01_00118564 predicted 922
13 SASI_Hs01_00118565 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108880 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242995 predicted 1050
2 SASI_Rn02_00242996 predicted 903
3 SASI_Rn02_00242997 predicted 908
4 SASI_Rn02_00242998 predicted 588
5 SASI_Rn02_00242999 predicted 633
6 SASI_Rn02_00243000 predicted 900
7 SASI_Rn02_00243001 predicted 1019
8 SASI_Rn02_00243002 predicted 890
9 SASI_Rn02_00243003 predicted 894
10 SASI_Rn02_00243004 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007526 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00020783 predicted 907
2 SASI_Mm02_00311839 predicted 938
3 SASI_Mm01_00020784 predicted 821
4 SASI_Mm01_00020787 predicted 903
5 SASI_Mm01_00020788 predicted 635
6 SASI_Mm02_00311840 predicted 308
7 SASI_Mm01_00020789 predicted 910
8 SASI_Mm01_00020790 predicted 904
9 SASI_Mm01_00020791 predicted 840
10 SASI_Mm02_00311841 predicted 908
11 SASI_Mm01_00020785 predicted 658
12 SASI_Mm01_00020786 predicted 715
13 SASI_Mm01_00020792 predicted 684
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007526
BARX1 MISSION shRNA Bacterial Glycerol Stock
BARX homeobox 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007526.4-907s21c1
Sequence:CCGGCCATGCCGTTTGCTTTCTAATCTCGAGATTAGAAAGCAAACGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007526.4-514s21c1
Sequence:CCGGAGTCGCACCGTATTCACTGAGCTCGAGCTCAGTGAATACGGTGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007526.4-159s21c1
Sequence:CCGGCCGCAGCTTCATGATCGAAGACTCGAGTCTTCGATCATGAAGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-226s1c1
Sequence:CCGGCCTGGCGCGAAAGCCAAGAAACTCGAGTTTCTTGGCTTTCGCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-400s1c1
Sequence:CCGGCGGAGGATGAAATGGAAGAAACTCGAGTTTCTTCCATTTCATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-331s1c1
Sequence:CCGGCCTGACAGAATAGATCTAGCTCTCGAGAGCTAGATCTATTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-566s1c1
Sequence:CCGGGCGACCGAAATTGCGAGGACTCTCGAGAGTCCTCGCAATTTCGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-372s1c1
Sequence:CCGGGTTACAGGTGAAGACGTGGTACTCGAGTACCACGTCTTCACCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007526
BARX1 MISSION shRNA shRNA Plasmid DNA
BARX homeobox 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007526.4-907s21c1
Sequence:CCGGCCATGCCGTTTGCTTTCTAATCTCGAGATTAGAAAGCAAACGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007526.4-514s21c1
Sequence:CCGGAGTCGCACCGTATTCACTGAGCTCGAGCTCAGTGAATACGGTGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007526.4-159s21c1
Sequence:CCGGCCGCAGCTTCATGATCGAAGACTCGAGTCTTCGATCATGAAGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-226s1c1
Sequence:CCGGCCTGGCGCGAAAGCCAAGAAACTCGAGTTTCTTGGCTTTCGCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-400s1c1
Sequence:CCGGCGGAGGATGAAATGGAAGAAACTCGAGTTTCTTCCATTTCATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-331s1c1
Sequence:CCGGCCTGACAGAATAGATCTAGCTCTCGAGAGCTAGATCTATTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-566s1c1
Sequence:CCGGGCGACCGAAATTGCGAGGACTCTCGAGAGTCCTCGCAATTTCGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-372s1c1
Sequence:CCGGGTTACAGGTGAAGACGTGGTACTCGAGTACCACGTCTTCACCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007526
BARX1 MISSION shRNA Lentiviral Transduction Particles
BARX homeobox 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431103    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007526.4-907s21c1
Sequence:CCGGCCATGCCGTTTGCTTTCTAATCTCGAGATTAGAAAGCAAACGGCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007526.4-514s21c1
Sequence:CCGGAGTCGCACCGTATTCACTGAGCTCGAGCTCAGTGAATACGGTGCGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007526.4-159s21c1
Sequence:CCGGCCGCAGCTTCATGATCGAAGACTCGAGTCTTCGATCATGAAGCTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070503    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-226s1c1
Sequence:CCGGCCTGGCGCGAAAGCCAAGAAACTCGAGTTTCTTGGCTTTCGCGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070504    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-400s1c1
Sequence:CCGGCGGAGGATGAAATGGAAGAAACTCGAGTTTCTTCCATTTCATCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070505    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-331s1c1
Sequence:CCGGCCTGACAGAATAGATCTAGCTCTCGAGAGCTAGATCTATTCTGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-566s1c1
Sequence:CCGGGCGACCGAAATTGCGAGGACTCTCGAGAGTCCTCGCAATTTCGGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007526.1-372s1c1
Sequence:CCGGGTTACAGGTGAAGACGTGGTACTCGAGTACCACGTCTTCACCTGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021570
BARX1 MISSION shRNA Bacterial Glycerol Stock
BARX homeobox 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000016478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-818s1c1
Sequence:CCGGCGGCCCAAGAAGAACTCAATTCTCGAGAATTGAGTTCTTCTTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-749s1c1
Sequence:CCGGCGGAGGATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-680s1c1
Sequence:CCGGCCGGACAGAATAGATCTTGCTCTCGAGAGCAAGATCTATTCTGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-646s1c1
Sequence:CCGGGAAACGCTTCGAGAAGCAGAACTCGAGTTCTGCTTCTCGAAGCGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-847s1c1
Sequence:CCGGCGAGCAGCTTACTGAGCAGGACTCGAGTCCTGCTCAGTAAGCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021570
BARX1 MISSION shRNA shRNA Plasmid DNA
BARX homeobox 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000016478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-818s1c1
Sequence:CCGGCGGCCCAAGAAGAACTCAATTCTCGAGAATTGAGTTCTTCTTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-749s1c1
Sequence:CCGGCGGAGGATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-680s1c1
Sequence:CCGGCCGGACAGAATAGATCTTGCTCTCGAGAGCAAGATCTATTCTGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-646s1c1
Sequence:CCGGGAAACGCTTCGAGAAGCAGAACTCGAGTTCTGCTTCTCGAAGCGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-847s1c1
Sequence:CCGGCGAGCAGCTTACTGAGCAGGACTCGAGTCCTGCTCAGTAAGCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021570
BARX1 MISSION shRNA Lentiviral Transduction Particles
BARX homeobox 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000016478    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-818s1c1
Sequence:CCGGCGGCCCAAGAAGAACTCAATTCTCGAGAATTGAGTTCTTCTTGGGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016480    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-749s1c1
Sequence:CCGGCGGAGGATGAAGTGGAAGAAACTCGAGTTTCTTCCACTTCATCCTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016479    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-680s1c1
Sequence:CCGGCCGGACAGAATAGATCTTGCTCTCGAGAGCAAGATCTATTCTGTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-646s1c1
Sequence:CCGGGAAACGCTTCGAGAAGCAGAACTCGAGTTCTGCTTCTCGAAGCGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016482    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021570.2-847s1c1
Sequence:CCGGCGAGCAGCTTACTGAGCAGGACTCGAGTCCTGCTCAGTAAGCTGCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks