EMAIL THIS PAGE TO A FRIEND

BARX2

BARX homeobox 2

100 Gene Product Result for
UniProtKB ID: Q9UMQ3, O43518, Q6NT51
Gene ID:
Human(8538) Summary: This gene encodes a member of the homeobox transcription factor family. A highly related protein in mouse has been shown to influence cellular processes that control cell adhesion and remodeling of the actin cytoskeleton in myoblast fusion and chondrogenesis. The encoded protein may also play a role in cancer progression. [provided by RefSeq, Jul 2008]
Mouse(12023) BarH-like homeobox 2
Rat(679701) BARX homeobox 2
sheep(443110) BARX homeobox 2
naked mole-rat(101724266) BARX homeobox 2
Zebrafish(100002200) BarH-like homeobox 2
chicken(395714) BARX homeobox 2
cow(617465) BARX homeobox 2
domestic cat(101095282) BARX homeobox 2
dog(609212) BARX homeobox 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003658 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003658 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003658 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013800 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013800 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013800 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU015701 MISSION® esiRNA esiRNA targeting human BARX2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003658 Rosetta Predictions human pricing
XM_001054100 Rosetta Predictions rat pricing
NM_013800 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198379 predicted 867
2 SASI_Hs02_00336035 predicted 960
3 SASI_Hs01_00198381 predicted 1172
4 SASI_Hs02_00336036 predicted 1217
5 SASI_Hs01_00198382 predicted 1183
6 SASI_Hs01_00198383 predicted 845
7 SASI_Hs01_00198384 predicted 1020
8 SASI_Hs02_00336037 predicted 690
9 SASI_Hs02_00336038 predicted 1029
10 SASI_Hs02_00336039 predicted 1198
11 SASI_Hs01_00198380 predicted 1134
12 SASI_Hs01_00198385 predicted 1028
13 SASI_Hs01_00198386 predicted 1138
14 SASI_Hs01_00198387 predicted 304
15 SASI_Hs01_00198388 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001054100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00274750 predicted 600
2 SASI_Rn02_00274751 predicted 593
3 SASI_Rn02_00274752 predicted 564
4 SASI_Rn02_00274753 predicted 564
5 SASI_Rn02_00274754 predicted 599
6 SASI_Rn02_00274755 predicted 567
7 SASI_Rn02_00274756 predicted 620
8 SASI_Rn02_00274757 predicted 556
9 SASI_Rn02_00274758 predicted 614
10 SASI_Rn02_00274759 predicted 589
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013800 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322754 predicted 764
2 SASI_Mm02_00322755 predicted 252
3 SASI_Mm02_00322756 predicted 302
4 SASI_Mm02_00322757 predicted 815
5 SASI_Mm02_00322758 predicted 252
6 SASI_Mm02_00322759 predicted 304
7 SASI_Mm01_00156020 predicted 731
8 SASI_Mm02_00322760 predicted 816
9 SASI_Mm02_00322761 predicted 544
10 SASI_Mm02_00322762 predicted 644
11 SASI_Mm01_00156013 predicted 511
12 SASI_Mm01_00156014 predicted 439
13 SASI_Mm01_00156015 predicted 402
14 SASI_Mm01_00156016 predicted 433
15 SASI_Mm01_00156017 predicted 537
16 SASI_Mm01_00156018 predicted 408
17 SASI_Mm01_00156019 predicted 397
18 SASI_Mm01_00156021 predicted 443
19 SASI_Mm01_00156022 predicted 431
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003658
BARX2 MISSION shRNA Bacterial Glycerol Stock
BARX homeobox 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003658.3-1095s1c1
Sequence:CCGGGCAAGCATTTGACAAAGACTTCTCGAGAAGTCTTTGTCAAATGCTTGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-826s1c1
Sequence:CCGGTGTGAAGCACAGGAACCGAAACTCGAGTTTCGGTTCCTGTGCTTCACATTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-646s1c1
Sequence:CCGGCGCAGGATGAAATGGAAGAAACTCGAGTTTCTTCCATTTCATCCTGCGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-203s1c1
Sequence:CCGGGCGATTACTTTGAGAAACTTTCTCGAGAAAGTTTCTCAAAGTAATCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-156s1c1
Sequence:CCGGGCGCTACAAGACTTTCATGATCTCGAGATCATGAAAGTCTTGTAGCGCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003658.4-1188s21c1
Sequence:CCGGCTATGTTGCAAGCCCTATATCCTCGAGGATATAGGGCTTGCAACATAGTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003658.4-257s21c1
Sequence:CCGGATATCCGCTCCTCTCGGTGATCTCGAGATCACCGAGAGGAGCGGATATTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003658
BARX2 MISSION shRNA shRNA Plasmid DNA
BARX homeobox 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003658.3-1095s1c1
Sequence:CCGGGCAAGCATTTGACAAAGACTTCTCGAGAAGTCTTTGTCAAATGCTTGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-826s1c1
Sequence:CCGGTGTGAAGCACAGGAACCGAAACTCGAGTTTCGGTTCCTGTGCTTCACATTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-646s1c1
Sequence:CCGGCGCAGGATGAAATGGAAGAAACTCGAGTTTCTTCCATTTCATCCTGCGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-203s1c1
Sequence:CCGGGCGATTACTTTGAGAAACTTTCTCGAGAAAGTTTCTCAAAGTAATCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000013235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-156s1c1
Sequence:CCGGGCGCTACAAGACTTTCATGATCTCGAGATCATGAAAGTCTTGTAGCGCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000423374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003658.4-1188s21c1
Sequence:CCGGCTATGTTGCAAGCCCTATATCCTCGAGGATATAGGGCTTGCAACATAGTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000415090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003658.4-257s21c1
Sequence:CCGGATATCCGCTCCTCTCGGTGATCTCGAGATCACCGAGAGGAGCGGATATTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003658
BARX2 MISSION shRNA Lentiviral Transduction Particles
BARX homeobox 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013233    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003658.3-1095s1c1
Sequence:CCGGGCAAGCATTTGACAAAGACTTCTCGAGAAGTCTTTGTCAAATGCTTGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013237    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-826s1c1
Sequence:CCGGTGTGAAGCACAGGAACCGAAACTCGAGTTTCGGTTCCTGTGCTTCACATTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013236    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-646s1c1
Sequence:CCGGCGCAGGATGAAATGGAAGAAACTCGAGTTTCTTCCATTTCATCCTGCGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013234    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-203s1c1
Sequence:CCGGGCGATTACTTTGAGAAACTTTCTCGAGAAAGTTTCTCAAAGTAATCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000013235    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003658.3-156s1c1
Sequence:CCGGGCGCTACAAGACTTTCATGATCTCGAGATCATGAAAGTCTTGTAGCGCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000423374    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003658.4-1188s21c1
Sequence:CCGGCTATGTTGCAAGCCCTATATCCTCGAGGATATAGGGCTTGCAACATAGTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000415090    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003658.4-257s21c1
Sequence:CCGGATATCCGCTCCTCTCGGTGATCTCGAGATCACCGAGAGGAGCGGATATTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013800
BARX2 MISSION shRNA Bacterial Glycerol Stock
BARX homeobox 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-526s1c1
Sequence:CCGGGCTGCAAGTGAAGACTTGGTACTCGAGTACCAAGTCTTCACTTGCAGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-99s1c1
Sequence:CCGGGCGACTACTTTGAGAAACTTTCTCGAGAAAGTTTCTCAAAGTAGTCGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-641s1c1
Sequence:CCGGCCCACATCAGAGGAGATTGAACTCGAGTTCAATCTCCTCTGATGTGGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-620s1c1
Sequence:CCGGCGCCCTAAGAAGAATTCCATTCTCGAGAATGGAATTCTTCTTAGGGCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-566s1c1
Sequence:CCGGTGGAAGAAGATGGTCCTTAAACTCGAGTTTAAGGACCATCTTCTTCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013800.2-263s21c1
Sequence:CCGGGACTTTCATGATCGATGAGATCTCGAGATCTCATCGATCATGAAAGTCTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013800.2-1109s21c1
Sequence:CCGGAGGGAGAGAAGACCTCTAAAGCTCGAGCTTTAGAGGTCTTCTCTCCCTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013800.2-605s21c1
Sequence:CCGGACGCAGAAGTCGCACCATCTTCTCGAGAAGATGGTGCGACTTCTGCGTTTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013800
BARX2 MISSION shRNA shRNA Plasmid DNA
BARX homeobox 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-526s1c1
Sequence:CCGGGCTGCAAGTGAAGACTTGGTACTCGAGTACCAAGTCTTCACTTGCAGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-99s1c1
Sequence:CCGGGCGACTACTTTGAGAAACTTTCTCGAGAAAGTTTCTCAAAGTAGTCGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-641s1c1
Sequence:CCGGCCCACATCAGAGGAGATTGAACTCGAGTTCAATCTCCTCTGATGTGGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-620s1c1
Sequence:CCGGCGCCCTAAGAAGAATTCCATTCTCGAGAATGGAATTCTTCTTAGGGCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000070512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-566s1c1
Sequence:CCGGTGGAAGAAGATGGTCCTTAAACTCGAGTTTAAGGACCATCTTCTTCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000436526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013800.2-263s21c1
Sequence:CCGGGACTTTCATGATCGATGAGATCTCGAGATCTCATCGATCATGAAAGTCTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000412716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013800.2-1109s21c1
Sequence:CCGGAGGGAGAGAAGACCTCTAAAGCTCGAGCTTTAGAGGTCTTCTCTCCCTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000428546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013800.2-605s21c1
Sequence:CCGGACGCAGAAGTCGCACCATCTTCTCGAGAAGATGGTGCGACTTCTGCGTTTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013800
BARX2 MISSION shRNA Lentiviral Transduction Particles
BARX homeobox 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-526s1c1
Sequence:CCGGGCTGCAAGTGAAGACTTGGTACTCGAGTACCAAGTCTTCACTTGCAGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-99s1c1
Sequence:CCGGGCGACTACTTTGAGAAACTTTCTCGAGAAAGTTTCTCAAAGTAGTCGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-641s1c1
Sequence:CCGGCCCACATCAGAGGAGATTGAACTCGAGTTCAATCTCCTCTGATGTGGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-620s1c1
Sequence:CCGGCGCCCTAAGAAGAATTCCATTCTCGAGAATGGAATTCTTCTTAGGGCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000070512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013800.1-566s1c1
Sequence:CCGGTGGAAGAAGATGGTCCTTAAACTCGAGTTTAAGGACCATCTTCTTCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000436526    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013800.2-263s21c1
Sequence:CCGGGACTTTCATGATCGATGAGATCTCGAGATCTCATCGATCATGAAAGTCTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000412716    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013800.2-1109s21c1
Sequence:CCGGAGGGAGAGAAGACCTCTAAAGCTCGAGCTTTAGAGGTCTTCTCTCCCTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000428546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013800.2-605s21c1
Sequence:CCGGACGCAGAAGTCGCACCATCTTCTCGAGAAGATGGTGCGACTTCTGCGTTTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)