EMAIL THIS PAGE TO A FRIEND

BASP1

brain abundant, membrane attached signal protein 1

116 Gene Product Result for
Synonyms: CAP-23 CAP23 NAP-22 NAP22
UniProtKB ID: P80723, B4DJA8, D3DTD5, O43596, Q5U0S0, Q9BWA5
Gene ID:
Human(10409) Summary: This gene encodes a membrane bound protein with several transient phosphorylation sites and PEST motifs. Conservation of proteins with PEST sequences among different species supports their functional significance. PEST sequences typically occur in proteins with high turnover rates. Immunological characteristics of this protein are species specific. This protein also undergoes N-terminal myristoylation. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2012]
Mouse(70350) brain abundant, membrane attached signal protein 1
Rat(64160) brain abundant, membrane attached signal protein 1
Zebrafish(569631) brain abundant, membrane attached signal protein 1
dog(612722) brain abundant, membrane attached signal protein 1
cow(286842) brain abundant, membrane attached signal protein 1
domestic cat(101088724) brain abundant, membrane attached signal protein 1
chicken(373905) brain abundant, membrane attached signal protein 1
domestic guinea pig(100735080) brain abundant, membrane attached signal protein 1
sheep(101119849) brain abundant, membrane attached signal protein 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0262 AQUA Peptide SDAAPAASDSKPSSAEPAPSS[K] mouse pricing
AQ0263 AQUA Peptide ETPAASEAPSSAA[K] mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006317 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006317 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006317 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027395 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027395 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027395 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU121851 MISSION® esiRNA esiRNA human BASP1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006317 Rosetta Predictions human pricing
NM_022300 Rosetta Predictions rat pricing
NM_027395 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006317 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069412 predicted 1221
2 SASI_Hs01_00069413 predicted 1294
3 SASI_Hs01_00069414 predicted 1284
4 SASI_Hs01_00069415 predicted 1217
5 SASI_Hs01_00069416 predicted 1210
6 SASI_Hs01_00069417 predicted 1262
7 SASI_Hs01_00069418 predicted 1305
8 SASI_Hs01_00069419 predicted 1293
9 SASI_Hs01_00069420 predicted 1265
10 SASI_Hs01_00069421 predicted 1261
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022300 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101945 predicted 429
2 SASI_Rn01_00101947 predicted 367
3 SASI_Rn01_00101948 predicted 347
4 SASI_Rn01_00101949 predicted 256
5 SASI_Rn01_00101950 predicted 347
6 SASI_Rn01_00101951 predicted 425
7 SASI_Rn01_00101952 predicted 405
8 SASI_Rn01_00101953 predicted 460
9 SASI_Rn01_00101954 predicted 463
10 SASI_Rn02_00263124 predicted 347
11 SASI_Rn01_00101946 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027395 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160108 predicted 248
2 SASI_Mm01_00160109 predicted 246
3 SASI_Mm01_00160110 predicted 202
4 SASI_Mm01_00160111 predicted 233
5 SASI_Mm01_00160112 predicted 246
6 SASI_Mm02_00332114 predicted 489
7 SASI_Mm01_00160113 predicted 15
8 SASI_Mm01_00160114 predicted 26
9 SASI_Mm02_00332115 predicted 485
10 SASI_Mm01_00160115 predicted 130
11 SASI_Mm01_00160116 predicted 492
12 SASI_Mm01_00160117 predicted 35
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006317
VALIDATED
BASP1 MISSION shRNA Bacterial Glycerol Stock
brain abundant, membrane attached signal protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000281334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-838s21c1
Sequence:CCGGACCAAACCGTAACCGTGAAAGCTCGAGCTTTCACGGTTACGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-863s21c1
Sequence:CCGGACAAGGACAGCCTATAGGAAACTCGAGTTTCCTATAGGCTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-225s21c1
Sequence:CCGGGACGAGAAAGCCAAGGAGAAACTCGAGTTTCTCCTTGGCTTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-1562s21c1
Sequence:CCGGGCACCTGTAGTTCTGTTTATTCTCGAGAATAAACAGAACTACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006317.3-212s21c1
Sequence:CCGGCTACAATGTGAACGACGAGAACTCGAGTTCTCGTCGTTCACATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-225s1c1
Sequence:CCGGGACGAGAAAGCCAAGGAGAAACTCGAGTTTCTCCTTGGCTTTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-230s1c1
Sequence:CCGGGAAAGCCAAGGAGAAAGACAACTCGAGTTGTCTTTCTCCTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-212s1c1
Sequence:CCGGCTACAATGTGAACGACGAGAACTCGAGTTCTCGTCGTTCACATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-1562s1c1
Sequence:CCGGGCACCTGTAGTTCTGTTTATTCTCGAGAATAAACAGAACTACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006317
VALIDATED
BASP1 MISSION shRNA shRNA Plasmid DNA
brain abundant, membrane attached signal protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000281334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-838s21c1
Sequence:CCGGACCAAACCGTAACCGTGAAAGCTCGAGCTTTCACGGTTACGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-863s21c1
Sequence:CCGGACAAGGACAGCCTATAGGAAACTCGAGTTTCCTATAGGCTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-225s21c1
Sequence:CCGGGACGAGAAAGCCAAGGAGAAACTCGAGTTTCTCCTTGGCTTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-1562s21c1
Sequence:CCGGGCACCTGTAGTTCTGTTTATTCTCGAGAATAAACAGAACTACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006317.3-212s21c1
Sequence:CCGGCTACAATGTGAACGACGAGAACTCGAGTTCTCGTCGTTCACATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-225s1c1
Sequence:CCGGGACGAGAAAGCCAAGGAGAAACTCGAGTTTCTCCTTGGCTTTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-230s1c1
Sequence:CCGGGAAAGCCAAGGAGAAAGACAACTCGAGTTGTCTTTCTCCTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-212s1c1
Sequence:CCGGCTACAATGTGAACGACGAGAACTCGAGTTCTCGTCGTTCACATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-1562s1c1
Sequence:CCGGGCACCTGTAGTTCTGTTTATTCTCGAGAATAAACAGAACTACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006317
VALIDATED
BASP1 MISSION shRNA Lentiviral Transduction Particles
brain abundant, membrane attached signal protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000281334    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-838s21c1
Sequence:CCGGACCAAACCGTAACCGTGAAAGCTCGAGCTTTCACGGTTACGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281335    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-863s21c1
Sequence:CCGGACAAGGACAGCCTATAGGAAACTCGAGTTTCCTATAGGCTGTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-225s21c1
Sequence:CCGGGACGAGAAAGCCAAGGAGAAACTCGAGTTTCTCCTTGGCTTTCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281254    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_006317.3-1562s21c1
Sequence:CCGGGCACCTGTAGTTCTGTTTATTCTCGAGAATAAACAGAACTACAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006317.3-212s21c1
Sequence:CCGGCTACAATGTGAACGACGAGAACTCGAGTTCTCGTCGTTCACATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180477    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-225s1c1
Sequence:CCGGGACGAGAAAGCCAAGGAGAAACTCGAGTTTCTCCTTGGCTTTCTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149347    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-230s1c1
Sequence:CCGGGAAAGCCAAGGAGAAAGACAACTCGAGTTGTCTTTCTCCTTGGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148376    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-212s1c1
Sequence:CCGGCTACAATGTGAACGACGAGAACTCGAGTTCTCGTCGTTCACATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147603    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006317.3-1562s1c1
Sequence:CCGGGCACCTGTAGTTCTGTTTATTCTCGAGAATAAACAGAACTACAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027395
BASP1 MISSION shRNA Bacterial Glycerol Stock
brain abundant, membrane attached signal protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-55s21c1
Sequence:CCGGGCCAAGGACAAAGACAAGAAGCTCGAGCTTCTTGTCTTTGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-152s21c1
Sequence:CCGGTCAAGGAGAGCACGGAGGAGACTCGAGTCTCCTCCGTGCTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-495s21c1
Sequence:CCGGGGCTTCAGACTCTAAACCTAGCTCGAGCTAGGTTTAGAGTCTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-47s21c1
Sequence:CCGGACGAGAAGGCCAAGGACAAAGCTCGAGCTTTGTCCTTGGCCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-33s21c1
Sequence:CCGGCTACAATGTGAACGACGAGAACTCGAGTTCTCGTCGTTCACATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027395.1-51s1c1
Sequence:CCGGGAAGGCCAAGGACAAAGACAACTCGAGTTGTCTTTGTCCTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027395.1-494s1c1
Sequence:CCGGCGGCTTCAGACTCTAAACCTACTCGAGTAGGTTTAGAGTCTGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027395
BASP1 MISSION shRNA shRNA Plasmid DNA
brain abundant, membrane attached signal protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-55s21c1
Sequence:CCGGGCCAAGGACAAAGACAAGAAGCTCGAGCTTCTTGTCTTTGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-152s21c1
Sequence:CCGGTCAAGGAGAGCACGGAGGAGACTCGAGTCTCCTCCGTGCTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-495s21c1
Sequence:CCGGGGCTTCAGACTCTAAACCTAGCTCGAGCTAGGTTTAGAGTCTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-47s21c1
Sequence:CCGGACGAGAAGGCCAAGGACAAAGCTCGAGCTTTGTCCTTGGCCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-33s21c1
Sequence:CCGGCTACAATGTGAACGACGAGAACTCGAGTTCTCGTCGTTCACATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027395.1-51s1c1
Sequence:CCGGGAAGGCCAAGGACAAAGACAACTCGAGTTGTCTTTGTCCTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027395.1-494s1c1
Sequence:CCGGCGGCTTCAGACTCTAAACCTACTCGAGTAGGTTTAGAGTCTGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027395
BASP1 MISSION shRNA Lentiviral Transduction Particles
brain abundant, membrane attached signal protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250262    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-55s21c1
Sequence:CCGGGCCAAGGACAAAGACAAGAAGCTCGAGCTTCTTGTCTTTGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250264    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-152s21c1
Sequence:CCGGTCAAGGAGAGCACGGAGGAGACTCGAGTCTCCTCCGTGCTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250266    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-495s21c1
Sequence:CCGGGGCTTCAGACTCTAAACCTAGCTCGAGCTAGGTTTAGAGTCTGAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-47s21c1
Sequence:CCGGACGAGAAGGCCAAGGACAAAGCTCGAGCTTTGTCCTTGGCCTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027395.1-33s21c1
Sequence:CCGGCTACAATGTGAACGACGAGAACTCGAGTTCTCGTCGTTCACATTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027395.1-51s1c1
Sequence:CCGGGAAGGCCAAGGACAAAGACAACTCGAGTTGTCTTTGTCCTTGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190229    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_027395.1-494s1c1
Sequence:CCGGCGGCTTCAGACTCTAAACCTACTCGAGTAGGTTTAGAGTCTGAAGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks