EMAIL THIS PAGE TO A FRIEND

BATF2

basic leucine zipper transcription factor, ATF-like 2

55 Gene Product Result for
Synonyms: SARI
UniProtKB ID: Q8N1L9, D9IC56, Q8NAF4, Q8NAL8, Q96EH4
Gene ID:
Mouse(74481) basic leucine zipper transcription factor, ATF-like 2
Rat(309178) basic leucine zipper transcription factor, ATF-like 2
sheep(101104944) basic leucine zipper transcription factor, ATF-like 2
domestic guinea pig(100721878) basic leucine zipper transcription factor, ATF-like 2
naked mole-rat(101704824) basic leucine zipper transcription factor, ATF-like 2
dog(483754) basic leucine zipper transcription factor, ATF-like 2
domestic cat(101095682) basic leucine zipper transcription factor, ATF-like 2
cow(522469) basic leucine zipper transcription factor, ATF-like 2
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_138456 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_138456 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_138456 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028967 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028967 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028967 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU041281 MISSION® esiRNA esiRNA human BATF2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_138456 Rosetta Predictions human pricing
XM_001071505 Rosetta Predictions rat pricing
XM_219527 Rosetta Predictions rat pricing
NM_028967 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138456 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00175366 predicted 866
2 SASI_Hs01_00175372 predicted 645
3 SASI_Hs01_00175367 predicted 841
4 SASI_Hs01_00175368 predicted 932
5 SASI_Hs01_00175369 predicted 140
6 SASI_Hs01_00175371 predicted 1061
7 SASI_Hs01_00175374 predicted 789
8 SASI_Hs01_00175375 predicted 1063
9 SASI_Hs02_00363628 predicted 693
10 SASI_Hs02_00363629 predicted 1339
11 SASI_Hs01_00175370 predicted 237
12 SASI_Hs01_00175373 predicted 1416
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071505 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335349 predicted 545
2 SASI_Rn02_00335350 predicted 249
3 SASI_Rn02_00335351 predicted 219
4 SASI_Rn02_00335352 predicted 336
5 SASI_Rn02_00335353 predicted 590
6 SASI_Rn02_00335354 predicted 428
7 SASI_Rn02_00335355 predicted 504
8 SASI_Rn02_00335356 predicted 514
9 SASI_Rn02_00335357 predicted 427
10 SASI_Rn02_00335358 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_219527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00378545 predicted 645
2 SASI_Rn02_00378546 predicted 432
3 SASI_Rn02_00378547 predicted 380
4 SASI_Rn02_00378548 predicted 251
5 SASI_Rn02_00378549 predicted 768
6 SASI_Rn02_00378550 predicted 396
7 SASI_Rn02_00378551 predicted 392
8 SASI_Rn02_00378552 predicted 262
9 SASI_Rn02_00378553 predicted 656
10 SASI_Rn02_00378554 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028967 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064531 predicted 362
2 SASI_Mm01_00064532 predicted 317
3 SASI_Mm01_00064533 predicted 201
4 SASI_Mm01_00064534 predicted 238
5 SASI_Mm01_00064535 predicted 802
6 SASI_Mm01_00064536 predicted 474
7 SASI_Mm01_00064537 predicted 1052
8 SASI_Mm01_00064538 predicted 879
9 SASI_Mm01_00064539 predicted 524
10 SASI_Mm01_00064540 predicted 1098
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138456
BATF2 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper transcription factor, ATF-like 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138456.3-1234s21c1
Sequence:CCGGAGTCCAAGGTCACGAAGACTTCTCGAGAAGTCTTCGTGACCTTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138456.3-691s21c1
Sequence:CCGGGGTCTTCCTCTAAGCTCAGTGCTCGAGCACTGAGCTTAGAGGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138456.3-934s21c1
Sequence:CCGGCCTCTGCTCAAGTCCACTTCTCTCGAGAGAAGTGGACTTGAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138456.3-1068s1c1
Sequence:CCGGCCCAGGATTTCACAGTCGAAACTCGAGTTTCGACTGTGAAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-554s1c1
Sequence:CCGGGCCTCATGATTCTCCCAGCCTCTCGAGAGGCTGGGAGAATCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-846s1c1
Sequence:CCGGGAGCACAAACCTGCTCTCTCACTCGAGTGAGAGAGCAGGTTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-652s1c1
Sequence:CCGGCTCTCCTGTTTGCCTCGCACACTCGAGTGTGCGAGGCAAACAGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-182s1c1
Sequence:CCGGGCAACAAAGGCAGCTGAAGAACTCGAGTTCTTCAGCTGCCTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138456
BATF2 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper transcription factor, ATF-like 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138456.3-1234s21c1
Sequence:CCGGAGTCCAAGGTCACGAAGACTTCTCGAGAAGTCTTCGTGACCTTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138456.3-691s21c1
Sequence:CCGGGGTCTTCCTCTAAGCTCAGTGCTCGAGCACTGAGCTTAGAGGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138456.3-934s21c1
Sequence:CCGGCCTCTGCTCAAGTCCACTTCTCTCGAGAGAAGTGGACTTGAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138456.3-1068s1c1
Sequence:CCGGCCCAGGATTTCACAGTCGAAACTCGAGTTTCGACTGTGAAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-554s1c1
Sequence:CCGGGCCTCATGATTCTCCCAGCCTCTCGAGAGGCTGGGAGAATCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-846s1c1
Sequence:CCGGGAGCACAAACCTGCTCTCTCACTCGAGTGAGAGAGCAGGTTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-652s1c1
Sequence:CCGGCTCTCCTGTTTGCCTCGCACACTCGAGTGTGCGAGGCAAACAGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-182s1c1
Sequence:CCGGGCAACAAAGGCAGCTGAAGAACTCGAGTTCTTCAGCTGCCTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138456
BATF2 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper transcription factor, ATF-like 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138456.3-1234s21c1
Sequence:CCGGAGTCCAAGGTCACGAAGACTTCTCGAGAAGTCTTCGTGACCTTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138456.3-691s21c1
Sequence:CCGGGGTCTTCCTCTAAGCTCAGTGCTCGAGCACTGAGCTTAGAGGAAGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416461    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138456.3-934s21c1
Sequence:CCGGCCTCTGCTCAAGTCCACTTCTCTCGAGAGAAGTGGACTTGAGCAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107400    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_138456.3-1068s1c1
Sequence:CCGGCCCAGGATTTCACAGTCGAAACTCGAGTTTCGACTGTGAAATCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107402    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-554s1c1
Sequence:CCGGGCCTCATGATTCTCCCAGCCTCTCGAGAGGCTGGGAGAATCATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107404    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-846s1c1
Sequence:CCGGGAGCACAAACCTGCTCTCTCACTCGAGTGAGAGAGCAGGTTTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107403    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-652s1c1
Sequence:CCGGCTCTCCTGTTTGCCTCGCACACTCGAGTGTGCGAGGCAAACAGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107401    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_138456.3-182s1c1
Sequence:CCGGGCAACAAAGGCAGCTGAAGAACTCGAGTTCTTCAGCTGCCTTTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028967
BATF2 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper transcription factor, ATF-like 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000233455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028967.1-1102s21c1
Sequence:CCGGAGTACCTGCACACCAACATTGCTCGAGCAATGTTGGTGTGCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-879s21c1
Sequence:CCGGAGTCCACTTCTAGCCTATGTCCTCGAGGACATAGGCTAGAAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-805s21c1
Sequence:CCGGACTCATTGGCAGAAGTCATCTCTCGAGAGATGACTTCTGCCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-762s21c1
Sequence:CCGGTTCACAGAACAGAGAGCATTTCTCGAGAAATGCTCTCTGTTCTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000233451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-625s21c1
Sequence:CCGGGGGTCTTTCTCTAAGCTTGATCTCGAGATCAAGCTTAGAGAAAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028967.1-1029s1c1
Sequence:CCGGGCCAAGTGCAAGAACATTGAACTCGAGTTCAATGTTCTTGCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-202s1c1
Sequence:CCGGCAGCACGAATCCTTGGAGAAACTCGAGTTTCTCCAAGGATTCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-367s1c1
Sequence:CCGGGCCAAGCAACCCTCAGGACAACTCGAGTTGTCCTGAGGGTTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-204s1c1
Sequence:CCGGGCACGAATCCTTGGAGAAACACTCGAGTGTTTCTCCAAGGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-803s1c1
Sequence:CCGGCCACTCATTGGCAGAAGTCATCTCGAGATGACTTCTGCCAATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028967
BATF2 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper transcription factor, ATF-like 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000233455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028967.1-1102s21c1
Sequence:CCGGAGTACCTGCACACCAACATTGCTCGAGCAATGTTGGTGTGCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-879s21c1
Sequence:CCGGAGTCCACTTCTAGCCTATGTCCTCGAGGACATAGGCTAGAAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-805s21c1
Sequence:CCGGACTCATTGGCAGAAGTCATCTCTCGAGAGATGACTTCTGCCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-762s21c1
Sequence:CCGGTTCACAGAACAGAGAGCATTTCTCGAGAAATGCTCTCTGTTCTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000233451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-625s21c1
Sequence:CCGGGGGTCTTTCTCTAAGCTTGATCTCGAGATCAAGCTTAGAGAAAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028967.1-1029s1c1
Sequence:CCGGGCCAAGTGCAAGAACATTGAACTCGAGTTCAATGTTCTTGCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-202s1c1
Sequence:CCGGCAGCACGAATCCTTGGAGAAACTCGAGTTTCTCCAAGGATTCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-367s1c1
Sequence:CCGGGCCAAGCAACCCTCAGGACAACTCGAGTTGTCCTGAGGGTTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-204s1c1
Sequence:CCGGGCACGAATCCTTGGAGAAACACTCGAGTGTTTCTCCAAGGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-803s1c1
Sequence:CCGGCCACTCATTGGCAGAAGTCATCTCGAGATGACTTCTGCCAATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028967
BATF2 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper transcription factor, ATF-like 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000233455    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028967.1-1102s21c1
Sequence:CCGGAGTACCTGCACACCAACATTGCTCGAGCAATGTTGGTGTGCAGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-879s21c1
Sequence:CCGGAGTCCACTTCTAGCCTATGTCCTCGAGGACATAGGCTAGAAGTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-805s21c1
Sequence:CCGGACTCATTGGCAGAAGTCATCTCTCGAGAGATGACTTCTGCCAATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-762s21c1
Sequence:CCGGTTCACAGAACAGAGAGCATTTCTCGAGAAATGCTCTCTGTTCTGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000233451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028967.1-625s21c1
Sequence:CCGGGGGTCTTTCTCTAAGCTTGATCTCGAGATCAAGCTTAGAGAAAGACCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095804    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028967.1-1029s1c1
Sequence:CCGGGCCAAGTGCAAGAACATTGAACTCGAGTTCAATGTTCTTGCACTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-202s1c1
Sequence:CCGGCAGCACGAATCCTTGGAGAAACTCGAGTTTCTCCAAGGATTCGTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-367s1c1
Sequence:CCGGGCCAAGCAACCCTCAGGACAACTCGAGTTGTCCTGAGGGTTGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095807    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-204s1c1
Sequence:CCGGGCACGAATCCTTGGAGAAACACTCGAGTGTTTCTCCAAGGATTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028967.1-803s1c1
Sequence:CCGGCCACTCATTGGCAGAAGTCATCTCGAGATGACTTCTGCCAATGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks