EMAIL THIS PAGE TO A FRIEND

BATF3

basic leucine zipper transcription factor, ATF-like 3

45 Gene Product Result for
Synonyms: JDP1 JUNDM1 SNFT
UniProtKB ID: Q9NR55
Gene ID:
Human(55509) Summary: This gene encodes a member of the basic leucine zipper protein family. The encoded protein functions as a transcriptional repressor when heterodimerizing with JUN. The protein may play a role in repression of interleukin-2 and matrix metalloproteinase-1 transcription.[provided by RefSeq, Feb 2009]
Mouse(381319) basic leucine zipper transcription factor, ATF-like 3
Rat(60462) basic leucine zipper transcription factor, ATF-like 3
Zebrafish(751677) basic leucine zipper transcription factor, ATF-like 3
chicken(421368) basic leucine zipper transcription factor, ATF-like 3
dog(490283) basic leucine zipper transcription factor, ATF-like 3
cow(535008) basic leucine zipper transcription factor, ATF-like 3
naked mole-rat(101729112) basic leucine zipper transcription factor, ATF-like 3
sheep(101115558) basic leucine zipper transcription factor, ATF-like 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_355268 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_355268 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_355268 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018664 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018664 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018664 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018664 Rosetta Predictions human pricing
NM_021865 Rosetta Predictions rat pricing
NM_030060 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018664 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108975 predicted 628
2 SASI_Hs01_00108976 predicted 526
3 SASI_Hs01_00108977 predicted 498
4 SASI_Hs01_00108978 predicted 753
5 SASI_Hs01_00108979 predicted 531
6 SASI_Hs02_00352172 predicted 753
7 SASI_Hs01_00108980 predicted 628
8 SASI_Hs01_00108982 predicted 626
9 SASI_Hs01_00108983 predicted 568
10 SASI_Hs01_00108984 predicted 468
11 SASI_Hs01_00108981 predicted 758
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021865 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00085657 predicted 157
2 SASI_Rn01_00085658 predicted 255
3 SASI_Rn02_00262891 predicted 134
4 SASI_Rn01_00085659 predicted 124
5 SASI_Rn01_00085660 predicted 161
6 SASI_Rn01_00085661 predicted 115
7 SASI_Rn01_00085662 predicted 149
8 SASI_Rn01_00085663 predicted 294
9 SASI_Rn01_00085664 predicted 176
10 SASI_Rn01_00085666 predicted 303
11 SASI_Rn01_00085665 predicted 147
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030060 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00041514 predicted 198
2 SASI_Mm01_00041515 predicted 256
3 SASI_Mm01_00041516 predicted 334
4 SASI_Mm01_00041517 predicted 451
5 SASI_Mm01_00041518 predicted 346
6 SASI_Mm01_00041519 predicted 379
7 SASI_Mm01_00041520 predicted 237
8 SASI_Mm01_00041521 predicted 428
9 SASI_Mm01_00041522 predicted 448
10 SASI_Mm01_00041523 predicted 442
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_355268
BATF3 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper transcription factor, ATF-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000096229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-183s1c1
Sequence:CCGGCCCAAGGACGATGACAGGAAACTCGAGTTTCCTGTCATCGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-254s1c1
Sequence:CCGGGCAGACCCAGAAGGCTGACAACTCGAGTTGTCAGCCTTCTGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-200s1c1
Sequence:CCGGGAAAGTTCGAAGGAGAGAGAACTCGAGTTCTCTCTCCTTCGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-245s1c1
Sequence:CCGGCCGGAAGAAGCAGACCCAGAACTCGAGTTCTGGGTCTGCTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000096233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-233s1c1
Sequence:CCGGAGCTCAGAGGAGCCGGAAGAACTCGAGTTCTTCCGGCTCCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_355268
BATF3 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper transcription factor, ATF-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000096229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-183s1c1
Sequence:CCGGCCCAAGGACGATGACAGGAAACTCGAGTTTCCTGTCATCGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-254s1c1
Sequence:CCGGGCAGACCCAGAAGGCTGACAACTCGAGTTGTCAGCCTTCTGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-200s1c1
Sequence:CCGGGAAAGTTCGAAGGAGAGAGAACTCGAGTTCTCTCTCCTTCGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-245s1c1
Sequence:CCGGCCGGAAGAAGCAGACCCAGAACTCGAGTTCTGGGTCTGCTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000096233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-233s1c1
Sequence:CCGGAGCTCAGAGGAGCCGGAAGAACTCGAGTTCTTCCGGCTCCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_355268
BATF3 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper transcription factor, ATF-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000096229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-183s1c1
Sequence:CCGGCCCAAGGACGATGACAGGAAACTCGAGTTTCCTGTCATCGTCCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-254s1c1
Sequence:CCGGGCAGACCCAGAAGGCTGACAACTCGAGTTGTCAGCCTTCTGGGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-200s1c1
Sequence:CCGGGAAAGTTCGAAGGAGAGAGAACTCGAGTTCTCTCTCCTTCGAACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096232    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-245s1c1
Sequence:CCGGCCGGAAGAAGCAGACCCAGAACTCGAGTTCTGGGTCTGCTTCTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000096233    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_355268.1-233s1c1
Sequence:CCGGAGCTCAGAGGAGCCGGAAGAACTCGAGTTCTTCCGGCTCCTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018664
VALIDATED
BATF3 MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper transcription factor, ATF-like 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018664.1-490s1c1
Sequence:CCGGGCACCTGACAGAGGCACTGAACTCGAGTTCAGTGCCTCTGTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018664.1-401s1c1
Sequence:CCGGGCTGACAAGCTCCATGAGGAACTCGAGTTCCTCATGGAGCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_018664.1-367s1c1
Sequence:CCGGTGCTCAGAGAAGTCGGAAGAACTCGAGTTCTTCCGACTTCTCTGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018664.1-544s1c1
Sequence:CCGGCCCTATGAACTTTGTGCCAGTCTCGAGACTGGCACAAAGTTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018664.1-412s1c1
Sequence:CCGGCCATGAGGAATATGAGAGCCTCTCGAGAGGCTCTCATATTCCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018664.1-630s21c1
Sequence:CCGGAGCAAGGAGCCTTGGTCATTTCTCGAGAAATGACCAAGGCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018664.1-404s21c1
Sequence:CCGGGACAAGCTCCATGAGGAATATCTCGAGATATTCCTCATGGAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018664.1-537s21c1
Sequence:CCGGTGCTCTGCCCTATGAACTTTGCTCGAGCAAAGTTCATAGGGCAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018664.1-367s21c1
Sequence:CCGGTGCTCAGAGAAGTCGGAAGAACTCGAGTTCTTCCGACTTCTCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018664
VALIDATED
BATF3 MISSION shRNA shRNA Plasmid DNA
basic leucine zipper transcription factor, ATF-like 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018664.1-490s1c1
Sequence:CCGGGCACCTGACAGAGGCACTGAACTCGAGTTCAGTGCCTCTGTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018664.1-401s1c1
Sequence:CCGGGCTGACAAGCTCCATGAGGAACTCGAGTTCCTCATGGAGCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_018664.1-367s1c1
Sequence:CCGGTGCTCAGAGAAGTCGGAAGAACTCGAGTTCTTCCGACTTCTCTGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018664.1-544s1c1
Sequence:CCGGCCCTATGAACTTTGTGCCAGTCTCGAGACTGGCACAAAGTTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018664.1-412s1c1
Sequence:CCGGCCATGAGGAATATGAGAGCCTCTCGAGAGGCTCTCATATTCCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018664.1-630s21c1
Sequence:CCGGAGCAAGGAGCCTTGGTCATTTCTCGAGAAATGACCAAGGCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018664.1-404s21c1
Sequence:CCGGGACAAGCTCCATGAGGAATATCTCGAGATATTCCTCATGGAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018664.1-537s21c1
Sequence:CCGGTGCTCTGCCCTATGAACTTTGCTCGAGCAAAGTTCATAGGGCAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018664.1-367s21c1
Sequence:CCGGTGCTCAGAGAAGTCGGAAGAACTCGAGTTCTTCCGACTTCTCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018664
VALIDATED
BATF3 MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper transcription factor, ATF-like 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A3
TRC Version: 1 Clone ID:NM_018664.1-490s1c1
Sequence:CCGGGCACCTGACAGAGGCACTGAACTCGAGTTCAGTGCCTCTGTCAGGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018664.1-401s1c1
Sequence:CCGGGCTGACAAGCTCCATGAGGAACTCGAGTTCCTCATGGAGCTTGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_018664.1-367s1c1
Sequence:CCGGTGCTCAGAGAAGTCGGAAGAACTCGAGTTCTTCCGACTTCTCTGAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018664.1-544s1c1
Sequence:CCGGCCCTATGAACTTTGTGCCAGTCTCGAGACTGGCACAAAGTTCATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018664.1-412s1c1
Sequence:CCGGCCATGAGGAATATGAGAGCCTCTCGAGAGGCTCTCATATTCCTCATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018664.1-630s21c1
Sequence:CCGGAGCAAGGAGCCTTGGTCATTTCTCGAGAAATGACCAAGGCTCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018664.1-404s21c1
Sequence:CCGGGACAAGCTCCATGAGGAATATCTCGAGATATTCCTCATGGAGCTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018664.1-537s21c1
Sequence:CCGGTGCTCTGCCCTATGAACTTTGCTCGAGCAAAGTTCATAGGGCAGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232277    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018664.1-367s21c1
Sequence:CCGGTGCTCAGAGAAGTCGGAAGAACTCGAGTTCTTCCGACTTCTCTGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks