EMAIL THIS PAGE TO A FRIEND

BATF

basic leucine zipper transcription factor, ATF-like

53 Gene Product Result for
Synonyms: B-ATF BATF1 SFA-2 SFA2
UniProtKB ID: Q16520
Gene ID:
Human(10538) Summary: The protein encoded by this gene is a nuclear basic leucine zipper protein that belongs to the AP-1/ATF superfamily of transcription factors. The leucine zipper of this protein mediates dimerization with members of the Jun family of proteins. This protein is thought to be a negative regulator of AP-1/ATF transcriptional events. [provided by RefSeq, Jul 2008]
Mouse(53314) basic leucine zipper transcription factor, ATF-like
Rat(299206) basic leucine zipper transcription factor, ATF-like
Zebrafish(564589) basic leucine zipper transcription factor, ATF-like
cow(617628) basic leucine zipper transcription factor, ATF-like
domestic cat(101097987) basic leucine zipper transcription factor, ATF-like
dog(611951) basic leucine zipper transcription factor, ATF-like
chicken(423364) basic leucine zipper transcription factor, ATF-like
naked mole-rat(101716426) basic leucine zipper transcription factor, ATF-like
domestic guinea pig(100714129) basic leucine zipper transcription factor, ATF-like
sheep(101110146) basic leucine zipper transcription factor, ATF-like
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016767 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016767 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016767 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006399 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006399 Rosetta Predictions human pricing
NM_001106748 Rosetta Predictions rat pricing
NM_016767 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00051668 predicted 716
2 SASI_Hs01_00051669 predicted 572
3 SASI_Hs01_00051670 predicted 304
4 SASI_Hs01_00051671 predicted 257
5 SASI_Hs01_00051672 predicted 301
6 SASI_Hs01_00051673 predicted 563
7 SASI_Hs01_00051674 predicted 654
8 SASI_Hs01_00051675 predicted 657
9 SASI_Hs01_00051676 predicted 464
10 SASI_Hs01_00051677 predicted 238
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00222008 predicted 734
2 SASI_Rn02_00222009 predicted 635
3 SASI_Rn02_00222010 predicted 391
4 SASI_Rn02_00222011 predicted 460
5 SASI_Rn02_00222012 predicted 449
6 SASI_Rn02_00222013 predicted 504
7 SASI_Rn02_00222014 predicted 294
8 SASI_Rn02_00222015 predicted 461
9 SASI_Rn02_00222016 predicted 421
10 SASI_Rn02_00222017 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016767 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179881 predicted 252
2 SASI_Mm01_00179882 predicted 378
3 SASI_Mm01_00179883 predicted 567
4 SASI_Mm02_00323528 predicted 564
5 SASI_Mm01_00179885 predicted 414
6 SASI_Mm02_00323529 predicted 677
7 SASI_Mm02_00323530 predicted 327
8 SASI_Mm01_00179888 predicted 421
9 SASI_Mm01_00179889 predicted 583
10 SASI_Mm02_00323531 predicted 328
11 SASI_Mm01_00179884 predicted 251
12 SASI_Mm01_00179886 predicted 681
13 SASI_Mm01_00179887 predicted 584
14 SASI_Mm01_00179890 predicted 253
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016767
BATF MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper transcription factor, ATF-like
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-390s1c1
Sequence:CCGGGCTCTCCGCAAAGAGATCAAACTCGAGTTTGATCTCTTTGCGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-258s1c1
Sequence:CCGGTCATCTGATGATGTGAGGAAACTCGAGTTTCCTCACATCATCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-395s1c1
Sequence:CCGGCCGCAAAGAGATCAAACAGCTCTCGAGAGCTGTTTGATCTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016767.1-677s1c1
Sequence:CCGGCTGGACAAGTATTGAACACAACTCGAGTTGTGTTCAATACTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-504s1c1
Sequence:CCGGGAGGTGGTATACAGTGCCCATCTCGAGATGGGCACTGTATACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-564s21c1
Sequence:CCGGCCCTGACCTTCTGGACAAGAACTCGAGTTCTTGTCCAGAAGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-244s21c1
Sequence:CCGGCTGGCAAACAGGACTCATCTGCTCGAGCAGATGAGTCCTGTTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-423s21c1
Sequence:CCGGGAGCTCAAGTACTTCACATCACTCGAGTGATGTGAAGTACTTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016767.2-703s21c1
Sequence:CCGGGTAGTGGTCAGAGGGACTTAACTCGAGTTAAGTCCCTCTGACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-391s21c1
Sequence:CCGGCTCTCCGCAAAGAGATCAAACCTCGAGGTTTGATCTCTTTGCGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016767
BATF MISSION shRNA shRNA Plasmid DNA
basic leucine zipper transcription factor, ATF-like
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-390s1c1
Sequence:CCGGGCTCTCCGCAAAGAGATCAAACTCGAGTTTGATCTCTTTGCGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-258s1c1
Sequence:CCGGTCATCTGATGATGTGAGGAAACTCGAGTTTCCTCACATCATCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-395s1c1
Sequence:CCGGCCGCAAAGAGATCAAACAGCTCTCGAGAGCTGTTTGATCTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016767.1-677s1c1
Sequence:CCGGCTGGACAAGTATTGAACACAACTCGAGTTGTGTTCAATACTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-504s1c1
Sequence:CCGGGAGGTGGTATACAGTGCCCATCTCGAGATGGGCACTGTATACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-564s21c1
Sequence:CCGGCCCTGACCTTCTGGACAAGAACTCGAGTTCTTGTCCAGAAGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-244s21c1
Sequence:CCGGCTGGCAAACAGGACTCATCTGCTCGAGCAGATGAGTCCTGTTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-423s21c1
Sequence:CCGGGAGCTCAAGTACTTCACATCACTCGAGTGATGTGAAGTACTTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016767.2-703s21c1
Sequence:CCGGGTAGTGGTCAGAGGGACTTAACTCGAGTTAAGTCCCTCTGACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-391s21c1
Sequence:CCGGCTCTCCGCAAAGAGATCAAACCTCGAGGTTTGATCTCTTTGCGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016767
BATF MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper transcription factor, ATF-like
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084769    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-390s1c1
Sequence:CCGGGCTCTCCGCAAAGAGATCAAACTCGAGTTTGATCTCTTTGCGGAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-258s1c1
Sequence:CCGGTCATCTGATGATGTGAGGAAACTCGAGTTTCCTCACATCATCAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084772    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-395s1c1
Sequence:CCGGCCGCAAAGAGATCAAACAGCTCTCGAGAGCTGTTTGATCTCTTTGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084768    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016767.1-677s1c1
Sequence:CCGGCTGGACAAGTATTGAACACAACTCGAGTTGTGTTCAATACTTGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084771    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016767.1-504s1c1
Sequence:CCGGGAGGTGGTATACAGTGCCCATCTCGAGATGGGCACTGTATACCACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-564s21c1
Sequence:CCGGCCCTGACCTTCTGGACAAGAACTCGAGTTCTTGTCCAGAAGGTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-244s21c1
Sequence:CCGGCTGGCAAACAGGACTCATCTGCTCGAGCAGATGAGTCCTGTTTGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235884    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-423s21c1
Sequence:CCGGGAGCTCAAGTACTTCACATCACTCGAGTGATGTGAAGTACTTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235888    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016767.2-703s21c1
Sequence:CCGGGTAGTGGTCAGAGGGACTTAACTCGAGTTAAGTCCCTCTGACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016767.2-391s21c1
Sequence:CCGGCTCTCCGCAAAGAGATCAAACCTCGAGGTTTGATCTCTTTGCGGAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006399
BATF MISSION shRNA Bacterial Glycerol Stock
basic leucine zipper transcription factor, ATF-like
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000021024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006399.2-746s1c1
Sequence:CCGGCGGGAACTGTCACGACTGGAACTCGAGTTCCAGTCGTGACAGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-436s1c1
Sequence:CCGGCGCGGCTCTACGCAAGGAGATCTCGAGATCTCCTTGCGTAGAGCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-571s1c1
Sequence:CCGGCCACGCATTCCACCAACCTCACTCGAGTGAGGTTGGTGGAATGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-306s1c1
Sequence:CCGGACTCATCTGATGATGTGAGAACTCGAGTTCTCACATCATCAGATGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-425s1c1
Sequence:CCGGGAGAAACAGAACGCGGCTCTACTCGAGTAGAGCCGCGTTCTGTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006399.3-315s21c1
Sequence:CCGGGATGATGTGAGAAGAGTTCAGCTCGAGCTGAACTCTTCTCACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006399.3-481s21c1
Sequence:CCGGAGTACTTCACGTCGGTGCTGACTCGAGTCAGCACCGACGTGAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006399.3-445s21c1
Sequence:CCGGTACGCAAGGAGATCAAGCAGCCTCGAGGCTGCTTGATCTCCTTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006399
BATF MISSION shRNA shRNA Plasmid DNA
basic leucine zipper transcription factor, ATF-like
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000021024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006399.2-746s1c1
Sequence:CCGGCGGGAACTGTCACGACTGGAACTCGAGTTCCAGTCGTGACAGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-436s1c1
Sequence:CCGGCGCGGCTCTACGCAAGGAGATCTCGAGATCTCCTTGCGTAGAGCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-571s1c1
Sequence:CCGGCCACGCATTCCACCAACCTCACTCGAGTGAGGTTGGTGGAATGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-306s1c1
Sequence:CCGGACTCATCTGATGATGTGAGAACTCGAGTTCTCACATCATCAGATGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-425s1c1
Sequence:CCGGGAGAAACAGAACGCGGCTCTACTCGAGTAGAGCCGCGTTCTGTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006399.3-315s21c1
Sequence:CCGGGATGATGTGAGAAGAGTTCAGCTCGAGCTGAACTCTTCTCACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006399.3-481s21c1
Sequence:CCGGAGTACTTCACGTCGGTGCTGACTCGAGTCAGCACCGACGTGAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006399.3-445s21c1
Sequence:CCGGTACGCAAGGAGATCAAGCAGCCTCGAGGCTGCTTGATCTCCTTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006399
BATF MISSION shRNA Lentiviral Transduction Particles
basic leucine zipper transcription factor, ATF-like
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000021024    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006399.2-746s1c1
Sequence:CCGGCGGGAACTGTCACGACTGGAACTCGAGTTCCAGTCGTGACAGTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-436s1c1
Sequence:CCGGCGCGGCTCTACGCAAGGAGATCTCGAGATCTCCTTGCGTAGAGCCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-571s1c1
Sequence:CCGGCCACGCATTCCACCAACCTCACTCGAGTGAGGTTGGTGGAATGCGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-306s1c1
Sequence:CCGGACTCATCTGATGATGTGAGAACTCGAGTTCTCACATCATCAGATGAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006399.2-425s1c1
Sequence:CCGGGAGAAACAGAACGCGGCTCTACTCGAGTAGAGCCGCGTTCTGTTTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006399.3-315s21c1
Sequence:CCGGGATGATGTGAGAAGAGTTCAGCTCGAGCTGAACTCTTCTCACATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417924    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006399.3-481s21c1
Sequence:CCGGAGTACTTCACGTCGGTGCTGACTCGAGTCAGCACCGACGTGAAGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432174    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006399.3-445s21c1
Sequence:CCGGTACGCAAGGAGATCAAGCAGCCTCGAGGCTGCTTGATCTCCTTGCGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks