EMAIL THIS PAGE TO A FRIEND

BAX

BCL2-associated X protein

157 Gene Product Result for
Synonyms: BCL2L4
Gene ID:
Human(581) Summary: The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. This protein forms a heterodimer with BCL2, and functions as an apoptotic activator. This protein is reported to interact with, and increase the opening of, the mitochondrial voltage-dependent anion channel (VDAC), which leads to the loss in membrane potential and the release of cytochrome c. The expression of this gene is regulated by the tumor suppressor P53 and has been shown to be involved in P53-mediated apoptosis. Multiple alternatively spliced transcript variants, which encode different isoforms, have been reported for this gene. [provided by RefSeq, Jul 2008]
Mouse(12028) BCL2-associated X protein
Rat(24887) Bcl2-associated X protein
naked mole-rat(101713575) BCL2-associated X protein
domestic guinea pig(100730890) BCL2-associated X protein
Goat(100846984) BCL2-associated X protein
sheep(443059) BCL2-associated X protein
dog(403523) BCL2-associated X protein
domestic cat(493837) BCL2-associated X protein
cow(280730) BCL2-associated X protein
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108447 Anti-BAX IgG fraction of antiserum canine, pig, human, bovine
immunohistochemistry, western blot pricing
B3428 Anti-Bax antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution rat, mouse, human
microarray, western blot pricing
SAB3500343 Anti-Bax antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
ELISA, immunocytochemistry, immunofluorescence, immunoprecipitation, western blot pricing
AV02020 Anti-BAX antibody produced in rabbit IgG fraction of antiserum bovine, canine, human
immunohistochemistry, western blot pricing
HPA027878 Anti-BAX antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB4502549 Anti-BAX antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunofluorescence, immunohistochemistry pricing
B8429 Anti-Bax antibody, Mouse monoclonal clone 6A7, purified from hybridoma cell culture mouse, rat, human
immunoprecipitation, microarray, western blot pricing
B8554 Anti-Bax antibody, Mouse monoclonal clone 2D2, purified from hybridoma cell culture bovine, human
microarray, western blot pricing
SAB5500012 Anti-BAX antibody, Rabbit monoclonal clone SP47, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry pricing
SAB4502546 Anti-BAX, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunofluorescence, western blot pricing
SAB4502547 Anti-BAX, C-Terminal antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunohistochemistry pricing
SAB4502548 Anti-BAX, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
ELISA, immunohistochemistry, western blot pricing
SAB4504690 Anti-phospho-Bax (pSer184) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry pricing
SAB4504081 Anti-phospho-Bax (pThr167) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, immunofluorescence pricing
SAB4301250 Anti-phospho-Bax (pThr167) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry pricing
B9054 Monoclonal Anti-Bax antibody produced in mouse 2 mg/mL, clone 5B7, purified immunoglobulin, buffered aqueous solution mouse
immunoprecipitation, microarray, western blot pricing
WH0000581M1 Monoclonal Anti-BAX antibody produced in mouse clone 1F5-1B7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004324 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007527 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007527 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007527 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU069421 MISSION® esiRNA esiRNA human BAX (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004324 Rosetta Predictions human pricing
NM_138761 Rosetta Predictions human pricing
NM_138763 Rosetta Predictions human pricing
NM_138764 Rosetta Predictions human pricing
NM_138765 Rosetta Predictions human pricing
NM_017059 Rosetta Predictions rat pricing
NM_007527 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337363 predicted 500
2 SASI_Hs01_00104997 predicted 637
3 SASI_Hs01_00104998 predicted 678
4 SASI_Hs01_00104999 predicted 436
5 SASI_Hs01_00105000 predicted 775
6 SASI_Hs01_00105001 predicted 685
7 SASI_Hs01_00105002 predicted 234
8 SASI_Hs01_00105003 predicted 684
9 SASI_Hs01_00105004 predicted 775
10 SASI_Hs01_00105005 predicted 441
11 SASI_Hs01_00105006 predicted 470
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138761 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363869 predicted 410
2 SASI_Hs02_00363870 predicted 463
3 SASI_Hs02_00363871 predicted 452
4 SASI_Hs01_00108512 predicted 440
5 SASI_Hs02_00363872 predicted 446
6 SASI_Hs01_00108513 predicted 455
7 SASI_Hs01_00108514 predicted 455
8 SASI_Hs02_00363873 predicted 449
9 SASI_Hs02_00363874 predicted 475
10 SASI_Hs01_00108518 predicted 447
11 SASI_Hs01_00108511 predicted 513
12 SASI_Hs01_00108515 predicted 505
13 SASI_Hs01_00108516 predicted 239
14 SASI_Hs01_00108517 predicted 591
15 SASI_Hs01_00108519 predicted 477
16 SASI_Hs01_00108520 predicted 612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363875 predicted 352
2 SASI_Hs01_00172876 predicted 387
3 SASI_Hs01_00172877 predicted 349
4 SASI_Hs01_00172878 predicted 298
5 SASI_Hs01_00172879 predicted 394
6 SASI_Hs01_00172880 predicted 421
7 SASI_Hs01_00172881 predicted 312
8 SASI_Hs01_00172882 predicted 303
9 SASI_Hs01_00172883 predicted 359
10 SASI_Hs01_00172884 predicted 298
11 SASI_Hs01_00172885 predicted 442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092477 predicted 606
2 SASI_Hs01_00092478 predicted 112
3 SASI_Hs02_00363876 predicted 717
4 SASI_Hs01_00092480 predicted 607
5 SASI_Hs01_00092481 predicted 605
6 SASI_Hs01_00092482 predicted 234
7 SASI_Hs01_00092483 predicted 684
8 SASI_Hs01_00092485 predicted 568
9 SASI_Hs02_00363877 predicted 701
10 SASI_Hs01_00092486 predicted 294
11 SASI_Hs01_00092479 predicted 223
12 SASI_Hs01_00092484 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00363878 predicted 505
2 SASI_Hs02_00363879 predicted 413
3 SASI_Hs02_00363880 predicted 502
4 SASI_Hs02_00363881 predicted 453
5 SASI_Hs01_00235066 predicted 442
6 SASI_Hs01_00235067 predicted 535
7 SASI_Hs02_00363882 predicted 502
8 SASI_Hs01_00235068 predicted 450
9 SASI_Hs01_00235069 predicted 449
10 SASI_Hs01_00235070 predicted 501
11 SASI_Hs01_00235071 predicted 238
12 SASI_Hs01_00235072 predicted 553
13 SASI_Hs01_00235073 predicted 454
14 SASI_Hs01_00235074 predicted 476
15 SASI_Hs01_00235075 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017059 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00088588 predicted 338
2 SASI_Rn01_00088589 predicted 331
3 SASI_Rn01_00088590 predicted 285
4 SASI_Rn01_00088591 predicted 314
5 SASI_Rn01_00088592 predicted 332
6 SASI_Rn01_00088593 predicted 353
7 SASI_Rn01_00088594 predicted 323
8 SASI_Rn01_00088595 predicted 229
9 SASI_Rn01_00088596 predicted 221
10 SASI_Rn01_00088597 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007527 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106747 predicted 450
2 SASI_Mm02_00311842 predicted 559
3 SASI_Mm01_00106749 predicted 302
4 SASI_Mm01_00106750 predicted 268
5 SASI_Mm01_00106751 predicted 403
6 SASI_Mm01_00106752 predicted 534
7 SASI_Mm01_00106753 predicted 441
8 SASI_Mm01_00106754 predicted 635
9 SASI_Mm01_00106755 predicted 492
10 SASI_Mm02_00311843 predicted 239
11 SASI_Mm01_00106748 predicted 279
12 SASI_Mm01_00106756 predicted 427
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004324
VALIDATED
BAX MISSION shRNA Bacterial Glycerol Stock
BCL2-associated X protein
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-409s21c1
Sequence:CCGGTTCTACTTTGCCAGCAAACTGCTCGAGCAGTTTGCTGGCAAAGTAGAATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-349s21c1
Sequence:CCGGCGAGTGGCAGCTGACATGTTTCTCGAGAAACATGTCAGCTGCCACTCGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-222s21c1
Sequence:CCGGTCAGGATGCGTCCACCAAGAACTCGAGTTCTTGGTGGACGCATCCTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-271s21c1
Sequence:CCGGGACGAACTGGACAGTAACATGCTCGAGCATGTTACTGTCCAGTTCGTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-110s21c1
Sequence:CCGGCCAGCTCTGAGCAGATCATGACTCGAGTCATGATCTGCTCAGAGCTGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-684s21c1
Sequence:CCGGATCATCAGATGTGGTCTATAACTCGAGTTATAGACCACATCTGATGATTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-713s21c1
Sequence:CCGGCCTTACGTGTCTGATCAATCCCTCGAGGGATTGATCAGACACGTAAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-456s21c1
Sequence:CCGGGCCGGAACTGATCAGAACCATCTCGAGATGGTTCTGATCAGTTCCGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004324.3-691s1c1
Sequence:CCGGGATGTGGTCTATAATGCGTTTCTCGAGAAACGCATTATAGACCACATCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004324.3-105s1c1
Sequence:CCGGGCCCACCAGCTCTGAGCAGATCTCGAGATCTGCTCAGAGCTGGTGGGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004324.3-685s1c1
Sequence:CCGGTCATCAGATGTGGTCTATAATCTCGAGATTATAGACCACATCTGATGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004324
VALIDATED
BAX MISSION shRNA shRNA Plasmid DNA
BCL2-associated X protein
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-409s21c1
Sequence:CCGGTTCTACTTTGCCAGCAAACTGCTCGAGCAGTTTGCTGGCAAAGTAGAATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-349s21c1
Sequence:CCGGCGAGTGGCAGCTGACATGTTTCTCGAGAAACATGTCAGCTGCCACTCGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000358747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-222s21c1
Sequence:CCGGTCAGGATGCGTCCACCAAGAACTCGAGTTCTTGGTGGACGCATCCTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-271s21c1
Sequence:CCGGGACGAACTGGACAGTAACATGCTCGAGCATGTTACTGTCCAGTTCGTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-110s21c1
Sequence:CCGGCCAGCTCTGAGCAGATCATGACTCGAGTCATGATCTGCTCAGAGCTGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-684s21c1
Sequence:CCGGATCATCAGATGTGGTCTATAACTCGAGTTATAGACCACATCTGATGATTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000312626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-713s21c1
Sequence:CCGGCCTTACGTGTCTGATCAATCCCTCGAGGGATTGATCAGACACGTAAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000327688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-456s21c1
Sequence:CCGGGCCGGAACTGATCAGAACCATCTCGAGATGGTTCTGATCAGTTCCGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004324.3-691s1c1
Sequence:CCGGGATGTGGTCTATAATGCGTTTCTCGAGAAACGCATTATAGACCACATCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004324.3-105s1c1
Sequence:CCGGGCCCACCAGCTCTGAGCAGATCTCGAGATCTGCTCAGAGCTGGTGGGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000033472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004324.3-685s1c1
Sequence:CCGGTCATCAGATGTGGTCTATAATCTCGAGATTATAGACCACATCTGATGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004324
VALIDATED
BAX MISSION shRNA Lentiviral Transduction Particles
BCL2-associated X protein
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-409s21c1
Sequence:CCGGTTCTACTTTGCCAGCAAACTGCTCGAGCAGTTTGCTGGCAAAGTAGAATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358738    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-349s21c1
Sequence:CCGGCGAGTGGCAGCTGACATGTTTCTCGAGAAACATGTCAGCTGCCACTCGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000358747    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-222s21c1
Sequence:CCGGTCAGGATGCGTCCACCAAGAACTCGAGTTCTTGGTGGACGCATCCTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-271s21c1
Sequence:CCGGGACGAACTGGACAGTAACATGCTCGAGCATGTTACTGTCCAGTTCGTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-110s21c1
Sequence:CCGGCCAGCTCTGAGCAGATCATGACTCGAGTCATGATCTGCTCAGAGCTGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-684s21c1
Sequence:CCGGATCATCAGATGTGGTCTATAACTCGAGTTATAGACCACATCTGATGATTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000312626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_004324.3-713s21c1
Sequence:CCGGCCTTACGTGTCTGATCAATCCCTCGAGGGATTGATCAGACACGTAAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000327688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004324.3-456s21c1
Sequence:CCGGGCCGGAACTGATCAGAACCATCTCGAGATGGTTCTGATCAGTTCCGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004324.3-691s1c1
Sequence:CCGGGATGTGGTCTATAATGCGTTTCTCGAGAAACGCATTATAGACCACATCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_004324.3-105s1c1
Sequence:CCGGGCCCACCAGCTCTGAGCAGATCTCGAGATCTGCTCAGAGCTGGTGGGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000033472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004324.3-685s1c1
Sequence:CCGGTCATCAGATGTGGTCTATAATCTCGAGATTATAGACCACATCTGATGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007527
VALIDATED
BAX MISSION shRNA Bacterial Glycerol Stock
BCL2-associated X protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000273037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-631s21c1
Sequence:CCGGTGGCAGACAGTGACCATCTTTCTCGAGAAAGATGGTCACTGTCTGCCATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-488s21c1
Sequence:CCGGTCAAGGCCCTGTGCACTAAAGCTCGAGCTTTAGTGCACAGGGCCTTGATTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-323s21c1
Sequence:CCGGGAGATGAACTGGACAGCAATACTCGAGTATTGCTGTCCAGTTCATCTCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-409s21c1
Sequence:CCGGGCAGCTGACATGTTTGCTGATCTCGAGATCAGCAAACATGTCAGCTGCTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-459s21c1
Sequence:CCGGCCTCTTCTACTTTGCTAGCAACTCGAGTTGCTAGCAAAGTAGAAGAGGTTTTTG
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007527.2-656s1c1
Sequence:CCGGACTGCCTTGGACTGTGTCTTTCTCGAGAAAGACACAGTCCAAGGCAGTTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007527.2-147s1c1
Sequence:CCGGCTACAGGGTTTCATCCAGGATCTCGAGATCCTGGATGAAACCCTGTAGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007527.2-404s1c1
Sequence:CCGGCCTCTTCTACTTTGCTAGCAACTCGAGTTGCTAGCAAAGTAGAAGAGGTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007527.2-268s1c1
Sequence:CCGGGAGATGAACTGGACAGCAATACTCGAGTATTGCTGTCCAGTTCATCTCTTTTT
Availability: Usually ships in 48 hours. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007527
VALIDATED
BAX MISSION shRNA shRNA Plasmid DNA
BCL2-associated X protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000273037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-631s21c1
Sequence:CCGGTGGCAGACAGTGACCATCTTTCTCGAGAAAGATGGTCACTGTCTGCCATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-488s21c1
Sequence:CCGGTCAAGGCCCTGTGCACTAAAGCTCGAGCTTTAGTGCACAGGGCCTTGATTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-323s21c1
Sequence:CCGGGAGATGAACTGGACAGCAATACTCGAGTATTGCTGTCCAGTTCATCTCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000272981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-409s21c1
Sequence:CCGGGCAGCTGACATGTTTGCTGATCTCGAGATCAGCAAACATGTCAGCTGCTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000273038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-459s21c1
Sequence:CCGGCCTCTTCTACTTTGCTAGCAACTCGAGTTGCTAGCAAAGTAGAAGAGGTTTTTG
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007527.2-656s1c1
Sequence:CCGGACTGCCTTGGACTGTGTCTTTCTCGAGAAAGACACAGTCCAAGGCAGTTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007527.2-147s1c1
Sequence:CCGGCTACAGGGTTTCATCCAGGATCTCGAGATCCTGGATGAAACCCTGTAGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007527.2-404s1c1
Sequence:CCGGCCTCTTCTACTTTGCTAGCAACTCGAGTTGCTAGCAAAGTAGAAGAGGTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
TRCN0000009671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007527.2-268s1c1
Sequence:CCGGGAGATGAACTGGACAGCAATACTCGAGTATTGCTGTCCAGTTCATCTCTTTTT
Availability: Usually ships in 4 to 6 weeks. (Outside of the US and Europe, please allow an additional 1-2 weeks for delivery)
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007527
VALIDATED
BAX MISSION shRNA Lentiviral Transduction Particles
BCL2-associated X protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000273037    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-631s21c1
Sequence:CCGGTGGCAGACAGTGACCATCTTTCTCGAGAAAGATGGTCACTGTCTGCCATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-488s21c1
Sequence:CCGGTCAAGGCCCTGTGCACTAAAGCTCGAGCTTTAGTGCACAGGGCCTTGATTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-323s21c1
Sequence:CCGGGAGATGAACTGGACAGCAATACTCGAGTATTGCTGTCCAGTTCATCTCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000272981    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-409s21c1
Sequence:CCGGGCAGCTGACATGTTTGCTGATCTCGAGATCAGCAAACATGTCAGCTGCTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000273038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_007527.3-459s21c1
Sequence:CCGGCCTCTTCTACTTTGCTAGCAACTCGAGTTGCTAGCAAAGTAGAAGAGGTTTTTG
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009668    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007527.2-656s1c1
Sequence:CCGGACTGCCTTGGACTGTGTCTTTCTCGAGAAAGACACAGTCCAAGGCAGTTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007527.2-147s1c1
Sequence:CCGGCTACAGGGTTTCATCCAGGATCTCGAGATCCTGGATGAAACCCTGTAGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007527.2-404s1c1
Sequence:CCGGCCTCTTCTACTTTGCTAGCAACTCGAGTTGCTAGCAAAGTAGAAGAGGTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)
TRCN0000009671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007527.2-268s1c1
Sequence:CCGGGAGATGAACTGGACAGCAATACTCGAGTATTGCTGTCCAGTTCATCTCTTTTT
Availability: Usually Ships in 8 Weeks. (Orders outside of US, please allow an additional 1-2 weeks for delivery)