EMAIL THIS PAGE TO A FRIEND

BAZ1A

bromodomain adjacent to zinc finger domain, 1A

147 Gene Product Result for
Synonyms: ACF1 WALp1 WCRF180 hACF1
UniProtKB ID: Q9NRL2, Q9NZ15, Q9P065, Q9UIG1, Q9Y3V3
Gene ID:
Human(11177) Summary: The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]
Mouse(217578) bromodomain adjacent to zinc finger domain 1A
Rat(314126) bromodomain adjacent to zinc finger domain, 1A
Zebrafish(334173) bromodomain adjacent to zinc finger domain, 1A
chicken(428884) bromodomain adjacent to zinc finger domain, 1A
dog(480287) bromodomain adjacent to zinc finger domain, 1A
domestic cat(101083344) bromodomain adjacent to zinc finger domain, 1A
Horse(100057597) bromodomain adjacent to zinc finger domain, 1A
cow(540621) bromodomain adjacent to zinc finger domain, 1A
sheep(101104014) bromodomain adjacent to zinc finger domain, 1A
Domestic Rabbit(100354971) bromodomain adjacent to zinc finger domain, 1A
domestic guinea pig(100727684) bromodomain adjacent to zinc finger domain, 1A
naked mole-rat(101715344) bromodomain adjacent to zinc finger domain, 1A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013448 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013448 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013448 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172576 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172576 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172576 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013815 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013815 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013815 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013448 Rosetta Predictions human pricing
NM_182648 Rosetta Predictions human pricing
XM_001079067 Rosetta Predictions rat pricing
XM_234156 Rosetta Predictions rat pricing
NM_013815 Rosetta Predictions mouse pricing
XM_885873 Rosetta Predictions mouse pricing
XM_915565 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013448 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190397 predicted 4989
2 SASI_Hs01_00190398 predicted 1261
3 SASI_Hs01_00190399 predicted 3434
4 SASI_Hs01_00190400 predicted 3446
5 SASI_Hs01_00190401 predicted 3046
6 SASI_Hs01_00190402 predicted 3271
7 SASI_Hs01_00190404 predicted 4013
8 SASI_Hs01_00190405 predicted 1114
9 SASI_Hs01_00190406 predicted 5321
10 SASI_Hs02_00344857 predicted 3300
11 SASI_Hs01_00190403 predicted 5119
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020301 predicted 4887
2 SASI_Hs01_00020302 predicted 1265
3 SASI_Hs01_00020303 predicted 3335
4 SASI_Hs01_00020304 predicted 3347
5 SASI_Hs01_00020305 predicted 2945
6 SASI_Hs01_00020306 predicted 3176
7 SASI_Hs01_00020308 predicted 3913
8 SASI_Hs01_00020309 predicted 1112
9 SASI_Hs01_00020310 predicted 5225
10 SASI_Hs02_00370809 predicted 3202
11 SASI_Hs01_00020307 predicted 5024
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079067 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363068 predicted 2975
2 SASI_Rn02_00363069 predicted 1677
3 SASI_Rn02_00363070 predicted 2418
4 SASI_Rn02_00363071 predicted 4583
5 SASI_Rn02_00363072 predicted 2391
6 SASI_Rn02_00363073 predicted 3201
7 SASI_Rn02_00363074 predicted 488
8 SASI_Rn02_00363075 predicted 4685
9 SASI_Rn02_00363076 predicted 297
10 SASI_Rn02_00363077 predicted 3151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234156 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388336 predicted 540
2 SASI_Rn02_00388337 predicted 2979
3 SASI_Rn02_00388338 predicted 2423
4 SASI_Rn02_00388339 predicted 4587
5 SASI_Rn02_00388340 predicted 2388
6 SASI_Rn02_00388341 predicted 3199
7 SASI_Rn02_00388342 predicted 4684
8 SASI_Rn02_00388343 predicted 298
9 SASI_Rn02_00388344 predicted 3157
10 SASI_Rn02_00388345 predicted 311
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013815 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322775 predicted 3462
2 SASI_Mm02_00322776 predicted 528
3 SASI_Mm02_00322777 predicted 2672
4 SASI_Mm02_00322778 predicted 4866
5 SASI_Mm02_00322779 predicted 1870
6 SASI_Mm02_00322780 predicted 1827
7 SASI_Mm02_00322781 predicted 1903
8 SASI_Mm02_00322782 predicted 1679
9 SASI_Mm02_00322783 predicted 3031
10 SASI_Mm02_00322784 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_885873 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00266225 predicted 3668
2 SASI_Mm02_00428251 predicted 2645
3 SASI_Mm01_00266226 predicted 732
4 SASI_Mm02_00428252 predicted 2270
5 SASI_Mm01_00266227 predicted 2874
6 SASI_Mm01_00266228 predicted 5066
7 SASI_Mm01_00266229 predicted 2066
8 SASI_Mm01_00266230 predicted 2033
9 SASI_Mm01_00266231 predicted 1879
10 SASI_Mm01_00266232 predicted 3229
11 SASI_Mm01_00266233 predicted 920
12 SASI_Mm01_00266234 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915565 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439587 predicted 3227
2 SASI_Mm02_00439588 predicted 298
3 SASI_Mm02_00439589 predicted 2441
4 SASI_Mm02_00439590 predicted 1629
5 SASI_Mm02_00439591 predicted 1592
6 SASI_Mm02_00439592 predicted 1444
7 SASI_Mm02_00439593 predicted 2794
8 SASI_Mm02_00439594 predicted 4112
9 SASI_Mm02_00439595 predicted 389
10 SASI_Mm02_00439596 predicted 628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013448
VALIDATED
BAZ1A MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 1A
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_013448.2-4260s1c1
Sequence:CCGGGCGATGAAGAAGAAGGTCAAACTCGAGTTTGACCTTCTTCTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013448.2-5183s1c1
Sequence:CCGGCCCAGTAATGTGGACCAAGTTCTCGAGAACTTGGTCCACATTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_013448.2-2989s1c1
Sequence:CCGGCGACCGCATGTATAGACGATACTCGAGTATCGTCTATACATGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013448.2-4425s1c1
Sequence:CCGGGCCAACAACAAGAACCTGGAACTCGAGTTCCAGGTTCTTGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-2502s21c1
Sequence:CCGGAGCAGGAGTTCCGGGAATTAACTCGAGTTAATTCCCGGAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-1117s21c1
Sequence:CCGGTGCAATTGATCCCTTACTATTCTCGAGAATAGTAAGGGATCAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-5453s21c1
Sequence:GTACCGGATTGGATACAGTACTGGTTTACTCGAGTAAACCAGTACTGTATCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-2652s21c1
Sequence:GTACCGGGAAATTCAACGGCAGATATATCTCGAGATATATCTGCCGTTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-3980s21c1
Sequence:CCGGCGTAGCGTGATATGGTCTAAACTCGAGTTTAGACCATATCACGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-3414s21c1
Sequence:CCGGCTGATAGCAAACCAACATATACTCGAGTATATGTTGGTTTGCTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-1298s21c1
Sequence:CCGGTCATCTCTTTCAACGTATAAACTCGAGTTTATACGTTGAAAGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-3562s21c1
Sequence:CCGGCAAGGTTACAGATCGACATATCTCGAGATATGTCGATCTGTAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013448
VALIDATED
BAZ1A MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 1A
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_013448.2-4260s1c1
Sequence:CCGGGCGATGAAGAAGAAGGTCAAACTCGAGTTTGACCTTCTTCTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013448.2-5183s1c1
Sequence:CCGGCCCAGTAATGTGGACCAAGTTCTCGAGAACTTGGTCCACATTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_013448.2-2989s1c1
Sequence:CCGGCGACCGCATGTATAGACGATACTCGAGTATCGTCTATACATGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013448.2-4425s1c1
Sequence:CCGGGCCAACAACAAGAACCTGGAACTCGAGTTCCAGGTTCTTGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-2502s21c1
Sequence:CCGGAGCAGGAGTTCCGGGAATTAACTCGAGTTAATTCCCGGAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-1117s21c1
Sequence:CCGGTGCAATTGATCCCTTACTATTCTCGAGAATAGTAAGGGATCAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-5453s21c1
Sequence:GTACCGGATTGGATACAGTACTGGTTTACTCGAGTAAACCAGTACTGTATCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-2652s21c1
Sequence:GTACCGGGAAATTCAACGGCAGATATATCTCGAGATATATCTGCCGTTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-3980s21c1
Sequence:CCGGCGTAGCGTGATATGGTCTAAACTCGAGTTTAGACCATATCACGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-3414s21c1
Sequence:CCGGCTGATAGCAAACCAACATATACTCGAGTATATGTTGGTTTGCTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-1298s21c1
Sequence:CCGGTCATCTCTTTCAACGTATAAACTCGAGTTTATACGTTGAAAGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-3562s21c1
Sequence:CCGGCAAGGTTACAGATCGACATATCTCGAGATATGTCGATCTGTAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013448
VALIDATED
BAZ1A MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 1A
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_013448.2-4260s1c1
Sequence:CCGGGCGATGAAGAAGAAGGTCAAACTCGAGTTTGACCTTCTTCTTCATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013448.2-5183s1c1
Sequence:CCGGCCCAGTAATGTGGACCAAGTTCTCGAGAACTTGGTCCACATTACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A3
TRC Version: 1 Clone ID:NM_013448.2-2989s1c1
Sequence:CCGGCGACCGCATGTATAGACGATACTCGAGTATCGTCTATACATGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013448.2-4425s1c1
Sequence:CCGGGCCAACAACAAGAACCTGGAACTCGAGTTCCAGGTTCTTGTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-2502s21c1
Sequence:CCGGAGCAGGAGTTCCGGGAATTAACTCGAGTTAATTCCCGGAACTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-1117s21c1
Sequence:CCGGTGCAATTGATCCCTTACTATTCTCGAGAATAGTAAGGGATCAATTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218199    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-5453s21c1
Sequence:GTACCGGATTGGATACAGTACTGGTTTACTCGAGTAAACCAGTACTGTATCCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-2652s21c1
Sequence:GTACCGGGAAATTCAACGGCAGATATATCTCGAGATATATCTGCCGTTGAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229786    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-3980s21c1
Sequence:CCGGCGTAGCGTGATATGGTCTAAACTCGAGTTTAGACCATATCACGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229785    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_013448.2-3414s21c1
Sequence:CCGGCTGATAGCAAACCAACATATACTCGAGTATATGTTGGTTTGCTATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-1298s21c1
Sequence:CCGGTCATCTCTTTCAACGTATAAACTCGAGTTTATACGTTGAAAGAGATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013448.2-3562s21c1
Sequence:CCGGCAAGGTTACAGATCGACATATCTCGAGATATGTCGATCTGTAACCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172576
BAZ1A MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 1A
Mouse
3 Products Total
TRC Number Price Set Price (3)? Select
TRCN0000176105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172576.1-1223s1c1
Sequence:CCGGGTGAGCAATGTGGTTCATTATCTCGAGATAATGAACCACATTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172576.1-817s1c1
Sequence:CCGGCTCTGAAGAGAAATTCCATTTCTCGAGAAATGGAATTTCTCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172576.1-962s1c1
Sequence:CCGGGATATTGAGGACAGAATCTATCTCGAGATAGATTCTGTCCTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172576
BAZ1A MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 1A
Mouse
3 Products Total
TRC Number Vector Price Set Price (3)? Select
TRCN0000176105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172576.1-1223s1c1
Sequence:CCGGGTGAGCAATGTGGTTCATTATCTCGAGATAATGAACCACATTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172576.1-817s1c1
Sequence:CCGGCTCTGAAGAGAAATTCCATTTCTCGAGAAATGGAATTTCTCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172576.1-962s1c1
Sequence:CCGGGATATTGAGGACAGAATCTATCTCGAGATAGATTCTGTCCTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172576
BAZ1A MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 1A
Mouse
3 Products Total
TRC Number Volume Titer Vector Price Set Price (3)? Select
TRCN0000176105    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172576.1-1223s1c1
Sequence:CCGGGTGAGCAATGTGGTTCATTATCTCGAGATAATGAACCACATTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172576.1-817s1c1
Sequence:CCGGCTCTGAAGAGAAATTCCATTTCTCGAGAAATGGAATTTCTCTTCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174786    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172576.1-962s1c1
Sequence:CCGGGATATTGAGGACAGAATCTATCTCGAGATAGATTCTGTCCTCAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013815
VALIDATED
BAZ1A MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 1A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000241702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013815.2-5818s21c1
Sequence:CCGGTTCCAAATACATGGTTGATTTCTCGAGAAATCAACCATGTATTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-534s21c1
Sequence:CCGGCTATGTCAAGGACCGATATTTCTCGAGAAATATCGGTCCTTGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-1102s21c1
Sequence:CCGGTATCGGAACAAAGCTATTAAACTCGAGTTTAATAGCTTTGTTCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-752s21c1
Sequence:CCGGATGCAATCGATCCCTTATTATCTCGAGATAATAAGGGATCGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-2752s21c1
Sequence:CCGGCGCGATCCTCAGGTATCTATTCTCGAGAATAGATACCTGAGGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013815
VALIDATED
BAZ1A MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 1A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000241702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013815.2-5818s21c1
Sequence:CCGGTTCCAAATACATGGTTGATTTCTCGAGAAATCAACCATGTATTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-534s21c1
Sequence:CCGGCTATGTCAAGGACCGATATTTCTCGAGAAATATCGGTCCTTGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-1102s21c1
Sequence:CCGGTATCGGAACAAAGCTATTAAACTCGAGTTTAATAGCTTTGTTCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-752s21c1
Sequence:CCGGATGCAATCGATCCCTTATTATCTCGAGATAATAAGGGATCGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-2752s21c1
Sequence:CCGGCGCGATCCTCAGGTATCTATTCTCGAGAATAGATACCTGAGGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013815
VALIDATED
BAZ1A MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 1A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000241702    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013815.2-5818s21c1
Sequence:CCGGTTCCAAATACATGGTTGATTTCTCGAGAAATCAACCATGTATTTGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-534s21c1
Sequence:CCGGCTATGTCAAGGACCGATATTTCTCGAGAAATATCGGTCCTTGACATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241700    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-1102s21c1
Sequence:CCGGTATCGGAACAAAGCTATTAAACTCGAGTTTAATAGCTTTGTTCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-752s21c1
Sequence:CCGGATGCAATCGATCCCTTATTATCTCGAGATAATAAGGGATCGATTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_013815.2-2752s21c1
Sequence:CCGGCGCGATCCTCAGGTATCTATTCTCGAGAATAGATACCTGAGGATCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks