EMAIL THIS PAGE TO A FRIEND

BAZ1B

bromodomain adjacent to zinc finger domain, 1B

Synonyms: WBSCR10 WBSCR9 WSTF
Gene ID:
Human(9031) Summary: This gene encodes a member of the bromodomain protein family. The bromodomain is a structural motif characteristic of proteins involved in chromatin-dependent regulation of transcription. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
Mouse(22385) bromodomain adjacent to zinc finger domain, 1B
Rat(368002) bromodomain adjacent to zinc finger domain, 1B
naked mole-rat(101708143) bromodomain adjacent to zinc finger domain, 1B
domestic guinea pig(100727949) bromodomain adjacent to zinc finger domain, 1B
sheep(101113982) bromodomain adjacent to zinc finger domain, 1B
Domestic Rabbit(100345544) bromodomain adjacent to zinc finger domain, 1B
Zebrafish(571727) bromodomain adjacent to zinc finger domain, 1B
domestic cat(101092412) bromodomain adjacent to zinc finger domain, 1B
cow(508442) bromodomain adjacent to zinc finger domain, 1B
Horse(100061668) bromodomain adjacent to zinc finger domain, 1B
dog(479719) bromodomain adjacent to zinc finger domain, 1B
chicken(427819) bromodomain adjacent to zinc finger domain, 1B
102 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032408 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011714 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011714 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011714 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_023005 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_023005 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_023005 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_023005 Rosetta Predictions human pricing
NM_032408 Rosetta Predictions human pricing
XM_001077467 Rosetta Predictions rat pricing
XM_347166 Rosetta Predictions rat pricing
NM_011714 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023005 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165726 predicted 1480
2 SASI_Hs01_00165727 predicted 2333
3 SASI_Hs01_00165728 predicted 2379
4 SASI_Hs01_00165729 predicted 3425
5 SASI_Hs01_00165730 predicted 1252
6 SASI_Hs01_00165731 predicted 3142
7 SASI_Hs01_00165732 predicted 1737
8 SASI_Hs01_00165733 predicted 1232
9 SASI_Hs01_00165734 predicted 3582
10 SASI_Hs01_00165735 predicted 3054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00239313 predicted 1466
2 SASI_Hs01_00239314 predicted 2328
3 SASI_Hs01_00239315 predicted 2365
4 SASI_Hs01_00239316 predicted 3417
5 SASI_Hs02_00359800 predicted 3092
6 SASI_Hs02_00359801 predicted 4451
7 SASI_Hs01_00239318 predicted 3135
8 SASI_Hs02_00359802 predicted 4574
9 SASI_Hs01_00239319 predicted 1726
10 SASI_Hs01_00239320 predicted 1221
11 SASI_Hs01_00239317 predicted 1187
12 SASI_Hs01_00239321 predicted 3514
13 SASI_Hs01_00239322 predicted 2984
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001077467 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00357129 predicted 1303
2 SASI_Rn02_00357130 predicted 4789
3 SASI_Rn02_00357131 predicted 1706
4 SASI_Rn02_00357132 predicted 4043
5 SASI_Rn02_00357133 predicted 3984
6 SASI_Rn02_00357134 predicted 3968
7 SASI_Rn02_00357135 predicted 2002
8 SASI_Rn02_00357136 predicted 1356
9 SASI_Rn02_00357137 predicted 3007
10 SASI_Rn02_00357138 predicted 1530
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_347166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00399566 predicted 1306
2 SASI_Rn02_00399567 predicted 4788
3 SASI_Rn02_00399568 predicted 1706
4 SASI_Rn02_00399569 predicted 4043
5 SASI_Rn02_00399570 predicted 3979
6 SASI_Rn02_00399571 predicted 3968
7 SASI_Rn02_00399572 predicted 1997
8 SASI_Rn02_00399573 predicted 1354
9 SASI_Rn02_00399574 predicted 3005
10 SASI_Rn02_00399575 predicted 1532
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011714 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131659 predicted 1069
2 SASI_Mm01_00131660 predicted 3130
3 SASI_Mm01_00131661 predicted 676
4 SASI_Mm01_00131663 predicted 3075
5 SASI_Mm01_00131664 predicted 1392
6 SASI_Mm01_00131666 predicted 2566
7 SASI_Mm01_00131667 predicted 2096
8 SASI_Mm01_00131668 predicted 2475
9 SASI_Mm02_00321280 predicted 3664
10 SASI_Mm02_00321281 predicted 2178
11 SASI_Mm01_00131662 predicted 3316
12 SASI_Mm01_00131665 predicted 3357
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032408
BAZ1B MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 1B
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000417181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032408.3-5029s21c1
Sequence:CCGGAGACTGGAGTCCTGCTTATAACTCGAGTTATAAGCAGGACTCCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032408.2-5541s21c1
Sequence:CCGGCCCACAACAAATCTAGCTCTACTCGAGTAGAGCTAGATTTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1653s21c1
Sequence:CCGGGCAGATGACTTTGTTGGATATCTCGAGATATCCAACAAAGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1105s21c1
Sequence:CCGGCGATACTTTATACGGCATAATCTCGAGATTATGCCGTATAAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-2223s21c1
Sequence:CCGGAGATGCTCAGTATCCTATTACCTCGAGGTAATAGGATACTGAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-3035s21c1
Sequence:CCGGTCATGCGCAGGACTCCTATTGCTCGAGCAATAGGAGTCCTGCGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1724s21c1
Sequence:CCGGCACCTAGGACCTCTAGTAAACCTCGAGGTTTACTAGAGGTCCTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1472s21c1
Sequence:CCGGATAAGCTGCACACTAACTTTCCTCGAGGAAAGTTAGTGTGCAGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-3094s21c1
Sequence:CCGGGATGAAGTTCCAGGATTATTCCTCGAGGAATAATCCTGGAACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032408
BAZ1B MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 1B
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000417181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032408.3-5029s21c1
Sequence:CCGGAGACTGGAGTCCTGCTTATAACTCGAGTTATAAGCAGGACTCCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032408.2-5541s21c1
Sequence:CCGGCCCACAACAAATCTAGCTCTACTCGAGTAGAGCTAGATTTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1653s21c1
Sequence:CCGGGCAGATGACTTTGTTGGATATCTCGAGATATCCAACAAAGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1105s21c1
Sequence:CCGGCGATACTTTATACGGCATAATCTCGAGATTATGCCGTATAAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-2223s21c1
Sequence:CCGGAGATGCTCAGTATCCTATTACCTCGAGGTAATAGGATACTGAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-3035s21c1
Sequence:CCGGTCATGCGCAGGACTCCTATTGCTCGAGCAATAGGAGTCCTGCGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1724s21c1
Sequence:CCGGCACCTAGGACCTCTAGTAAACCTCGAGGTTTACTAGAGGTCCTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1472s21c1
Sequence:CCGGATAAGCTGCACACTAACTTTCCTCGAGGAAAGTTAGTGTGCAGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-3094s21c1
Sequence:CCGGGATGAAGTTCCAGGATTATTCCTCGAGGAATAATCCTGGAACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032408
BAZ1B MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 1B
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000417181    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032408.3-5029s21c1
Sequence:CCGGAGACTGGAGTCCTGCTTATAACTCGAGTTATAAGCAGGACTCCAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338431    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032408.2-5541s21c1
Sequence:CCGGCCCACAACAAATCTAGCTCTACTCGAGTAGAGCTAGATTTGTTGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338494    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1653s21c1
Sequence:CCGGGCAGATGACTTTGTTGGATATCTCGAGATATCCAACAAAGTCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338493    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1105s21c1
Sequence:CCGGCGATACTTTATACGGCATAATCTCGAGATTATGCCGTATAAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380794    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-2223s21c1
Sequence:CCGGAGATGCTCAGTATCCTATTACCTCGAGGTAATAGGATACTGAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-3035s21c1
Sequence:CCGGTCATGCGCAGGACTCCTATTGCTCGAGCAATAGGAGTCCTGCGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1724s21c1
Sequence:CCGGCACCTAGGACCTCTAGTAAACCTCGAGGTTTACTAGAGGTCCTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-1472s21c1
Sequence:CCGGATAAGCTGCACACTAACTTTCCTCGAGGAAAGTTAGTGTGCAGCTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032408.2-3094s21c1
Sequence:CCGGGATGAAGTTCCAGGATTATTCCTCGAGGAATAATCCTGGAACTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011714
VALIDATED
BAZ1B MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 1B
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011714.2-5721s21c1
Sequence:CCGGCTATGATATGTGTTCGCTTTACTCGAGTAAAGCGAACACATATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011714.2-466s21c1
Sequence:CCGGGAACGCATTTGGACGTGTAAGCTCGAGCTTACACGTCCAAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011714.2-1348s21c1
Sequence:CCGGCACTTGGAGAAGTCGTTAAATCTCGAGATTTAACGACTTCTCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011714.2-3124s21c1
Sequence:CCGGAGCATTGACTACCGGTTTAAGCTCGAGCTTAAACCGGTAGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011714.2-2495s21c1
Sequence:CCGGATGAGGTGCAAGACGAATTTCCTCGAGGAAATTCGTCTTGCACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011714.1-1046s1c1
Sequence:CCGGCGATACTTTATTCGGCATAATCTCGAGATTATGCCGAATAAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011714.1-3629s1c1
Sequence:CCGGCCTAAGCAGAAGAAGCGGAAACTCGAGTTTCCGCTTCTTCTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011714.1-1025s1c1
Sequence:CCGGCCACCAAATAAGGAGATACTTCTCGAGAAGTATCTCCTTATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011714.1-3392s1c1
Sequence:CCGGCGGAAGCCAAATTTGGGTCTACTCGAGTAGACCCAAATTTGGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011714.1-1139s1c1
Sequence:CCGGCCTAGCAAGTTCAGTGACTTTCTCGAGAAAGTCACTGAACTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011714
VALIDATED
BAZ1B MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 1B
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011714.2-5721s21c1
Sequence:CCGGCTATGATATGTGTTCGCTTTACTCGAGTAAAGCGAACACATATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011714.2-466s21c1
Sequence:CCGGGAACGCATTTGGACGTGTAAGCTCGAGCTTACACGTCCAAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011714.2-1348s21c1
Sequence:CCGGCACTTGGAGAAGTCGTTAAATCTCGAGATTTAACGACTTCTCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011714.2-3124s21c1
Sequence:CCGGAGCATTGACTACCGGTTTAAGCTCGAGCTTAAACCGGTAGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011714.2-2495s21c1
Sequence:CCGGATGAGGTGCAAGACGAATTTCCTCGAGGAAATTCGTCTTGCACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011714.1-1046s1c1
Sequence:CCGGCGATACTTTATTCGGCATAATCTCGAGATTATGCCGAATAAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011714.1-3629s1c1
Sequence:CCGGCCTAAGCAGAAGAAGCGGAAACTCGAGTTTCCGCTTCTTCTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011714.1-1025s1c1
Sequence:CCGGCCACCAAATAAGGAGATACTTCTCGAGAAGTATCTCCTTATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011714.1-3392s1c1
Sequence:CCGGCGGAAGCCAAATTTGGGTCTACTCGAGTAGACCCAAATTTGGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011714.1-1139s1c1
Sequence:CCGGCCTAGCAAGTTCAGTGACTTTCTCGAGAAAGTCACTGAACTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011714
VALIDATED
BAZ1B MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 1B
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238164    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011714.2-5721s21c1
Sequence:CCGGCTATGATATGTGTTCGCTTTACTCGAGTAAAGCGAACACATATCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238163    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011714.2-466s21c1
Sequence:CCGGGAACGCATTTGGACGTGTAAGCTCGAGCTTACACGTCCAAATGCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238162    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011714.2-1348s21c1
Sequence:CCGGCACTTGGAGAAGTCGTTAAATCTCGAGATTTAACGACTTCTCCAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011714.2-3124s21c1
Sequence:CCGGAGCATTGACTACCGGTTTAAGCTCGAGCTTAAACCGGTAGTCAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011714.2-2495s21c1
Sequence:CCGGATGAGGTGCAAGACGAATTTCCTCGAGGAAATTCGTCTTGCACCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108935    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011714.1-1046s1c1
Sequence:CCGGCGATACTTTATTCGGCATAATCTCGAGATTATGCCGAATAAAGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011714.1-3629s1c1
Sequence:CCGGCCTAAGCAGAAGAAGCGGAAACTCGAGTTTCCGCTTCTTCTGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011714.1-1025s1c1
Sequence:CCGGCCACCAAATAAGGAGATACTTCTCGAGAAGTATCTCCTTATTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011714.1-3392s1c1
Sequence:CCGGCGGAAGCCAAATTTGGGTCTACTCGAGTAGACCCAAATTTGGCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108937    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011714.1-1139s1c1
Sequence:CCGGCCTAGCAAGTTCAGTGACTTTCTCGAGAAAGTCACTGAACTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023005
VALIDATED
BAZ1B MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 1B
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-5516s1c1
Sequence:CCGGCCCACAACAAATCTAGCTCTACTCGAGTAGAGCTAGATTTGTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-2918s1c1
Sequence:CCGGCGGGAAATCCAGGAAAGAGAACTCGAGTTCTCTTTCCTGGATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-1660s1c1
Sequence:CCGGGCAGATGACTTTGTTGGATATCTCGAGATATCCAACAAAGTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-1112s1c1
Sequence:CCGGCGATACTTTATACGGCATAATCTCGAGATTATGCCGTATAAAGTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_023005.2-4001s1c1
Sequence:CCGGGCCCTCTATGAAGTACCAGATCTCGAGATCTGGTACTTCATAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023005
VALIDATED
BAZ1B MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 1B
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-5516s1c1
Sequence:CCGGCCCACAACAAATCTAGCTCTACTCGAGTAGAGCTAGATTTGTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-2918s1c1
Sequence:CCGGCGGGAAATCCAGGAAAGAGAACTCGAGTTCTCTTTCCTGGATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-1660s1c1
Sequence:CCGGGCAGATGACTTTGTTGGATATCTCGAGATATCCAACAAAGTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-1112s1c1
Sequence:CCGGCGATACTTTATACGGCATAATCTCGAGATTATGCCGTATAAAGTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_023005.2-4001s1c1
Sequence:CCGGGCCCTCTATGAAGTACCAGATCTCGAGATCTGGTACTTCATAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023005
VALIDATED
BAZ1B MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 1B
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-5516s1c1
Sequence:CCGGCCCACAACAAATCTAGCTCTACTCGAGTAGAGCTAGATTTGTTGTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-2918s1c1
Sequence:CCGGCGGGAAATCCAGGAAAGAGAACTCGAGTTCTCTTTCCTGGATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-1660s1c1
Sequence:CCGGGCAGATGACTTTGTTGGATATCTCGAGATATCCAACAAAGTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_023005.2-1112s1c1
Sequence:CCGGCGATACTTTATACGGCATAATCTCGAGATTATGCCGTATAAAGTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A3
TRC Version: 1 Clone ID:NM_023005.2-4001s1c1
Sequence:CCGGGCCCTCTATGAAGTACCAGATCTCGAGATCTGGTACTTCATAGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks