EMAIL THIS PAGE TO A FRIEND

BAZ2A

bromodomain adjacent to zinc finger domain, 2A

235 Gene Product Result for
Synonyms: TIP5 WALp3
UniProtKB ID: Q9UIF9, B3KN66, O00536, O15030, Q68DI8, Q96H26
Gene ID:
Mouse(116848) bromodomain adjacent to zinc finger domain, 2A
Rat(304601) bromodomain adjacent to zinc finger domain, 2A
Zebrafish(450079) bromodomain adjacent to zinc finger domain, 2A
cow(509799) bromodomain adjacent to zinc finger domain, 2A
Horse(100052682) bromodomain adjacent to zinc finger domain, 2A
domestic cat(101086821) bromodomain adjacent to zinc finger domain, 2A
dog(481116) bromodomain adjacent to zinc finger domain, 2A
sheep(101106579) bromodomain adjacent to zinc finger domain, 2A
domestic guinea pig(100731132) bromodomain adjacent to zinc finger domain, 2A
naked mole-rat(101702266) bromodomain adjacent to zinc finger domain, 2A
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013449 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013449 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013449 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_054078 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054078 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054078 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU014601 MISSION® esiRNA esiRNA targeting human BAZ2A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013449 Rosetta Predictions human pricing
NM_001107158 Rosetta Predictions rat pricing
NM_054078 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013449 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068405 predicted 1124
2 SASI_Hs01_00068406 predicted 4769
3 SASI_Hs01_00068407 predicted 3354
4 SASI_Hs01_00068408 predicted 1811
5 SASI_Hs02_00344858 predicted 1198
6 SASI_Hs01_00068409 predicted 5841
7 SASI_Hs02_00344859 predicted 4575
8 SASI_Hs01_00068411 predicted 1529
9 SASI_Hs01_00068412 predicted 5661
10 SASI_Hs01_00068413 predicted 3575
11 SASI_Hs01_00068410 predicted 1449
12 SASI_Hs01_00068414 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107158 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00226075 predicted 1688
2 SASI_Rn02_00226076 predicted 1627
3 SASI_Rn02_00226077 predicted 394
4 SASI_Rn02_00226078 predicted 3261
5 SASI_Rn02_00226079 predicted 1108
6 SASI_Rn02_00226080 predicted 3356
7 SASI_Rn02_00226081 predicted 622
8 SASI_Rn02_00226082 predicted 867
9 SASI_Rn02_00226083 predicted 1066
10 SASI_Rn02_00226084 predicted 202
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054078 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142800 predicted 3063
2 SASI_Mm01_00142801 predicted 3830
3 SASI_Mm01_00142802 predicted 3341
4 SASI_Mm01_00142803 predicted 1333
5 SASI_Mm01_00142805 predicted 3341
6 SASI_Mm02_00338003 predicted 3134
7 SASI_Mm01_00142806 predicted 5155
8 SASI_Mm02_00338004 predicted 2769
9 SASI_Mm01_00142807 predicted 3499
10 SASI_Mm02_00338005 predicted 3102
11 SASI_Mm01_00142799 predicted 3485
12 SASI_Mm01_00142804 predicted 1542
13 SASI_Mm01_00142808 predicted 1781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013449
BAZ2A MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 2A
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013449.2-4583s1c1
Sequence:CCGGCCTGCCTTTCAAGAAGGGATTCTCGAGAATCCCTTCTTGAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013449.2-596s1c1
Sequence:CCGGCCAAGTCATAACACTAACCTTCTCGAGAAGGTTAGTGTTATGACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013449.2-3484s1c1
Sequence:CCGGGCCGTATTTGGCTGGTATCTTCTCGAGAAGATACCAGCCAAATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013449.3-3567s21c1
Sequence:CCGGTACTGGGTATTGCCGTATTTGCTCGAGCAAATACGGCAATACCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013449.3-5079s21c1
Sequence:CCGGACCACTACAGAGATATCATATCTCGAGATATGATATCTCTGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013449.3-3791s21c1
Sequence:CCGGTATGCAACCTAGGCATCTTAACTCGAGTTAAGATGCCTAGGTTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013449
BAZ2A MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 2A
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013449.2-4583s1c1
Sequence:CCGGCCTGCCTTTCAAGAAGGGATTCTCGAGAATCCCTTCTTGAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013449.2-596s1c1
Sequence:CCGGCCAAGTCATAACACTAACCTTCTCGAGAAGGTTAGTGTTATGACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013449.2-3484s1c1
Sequence:CCGGGCCGTATTTGGCTGGTATCTTCTCGAGAAGATACCAGCCAAATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013449.3-3567s21c1
Sequence:CCGGTACTGGGTATTGCCGTATTTGCTCGAGCAAATACGGCAATACCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013449.3-5079s21c1
Sequence:CCGGACCACTACAGAGATATCATATCTCGAGATATGATATCTCTGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013449.3-3791s21c1
Sequence:CCGGTATGCAACCTAGGCATCTTAACTCGAGTTAAGATGCCTAGGTTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013449
BAZ2A MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 2A
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013449.2-4583s1c1
Sequence:CCGGCCTGCCTTTCAAGAAGGGATTCTCGAGAATCCCTTCTTGAAAGGCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013449.2-596s1c1
Sequence:CCGGCCAAGTCATAACACTAACCTTCTCGAGAAGGTTAGTGTTATGACTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013449.2-3484s1c1
Sequence:CCGGGCCGTATTTGGCTGGTATCTTCTCGAGAAGATACCAGCCAAATACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367865    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013449.3-3567s21c1
Sequence:CCGGTACTGGGTATTGCCGTATTTGCTCGAGCAAATACGGCAATACCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358514    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013449.3-5079s21c1
Sequence:CCGGACCACTACAGAGATATCATATCTCGAGATATGATATCTCTGTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013449.3-3791s21c1
Sequence:CCGGTATGCAACCTAGGCATCTTAACTCGAGTTAAGATGCCTAGGTTGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054078
VALIDATED
BAZ2A MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 2A
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-3281s1c1
Sequence:CCGGGCACAGTTACTGAAGATGAAACTCGAGTTTCATCTTCAGTAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-3904s1c1
Sequence:CCGGGCCTCCTCTAAACCAATGAATCTCGAGATTCATTGGTTTAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-3905s1c1
Sequence:CCGGCCTCCTCTAAACCAATGAATACTCGAGTATTCATTGGTTTAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-1818s1c1
Sequence:CCGGCCGACCTCGAAACAATGAGAACTCGAGTTCTCATTGTTTCGAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-501s1c1
Sequence:CCGGCCAGGATGTAAGCAGTGACATCTCGAGATGTCACTGCTTACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054078.2-2226s21c1
Sequence:CCGGATACTGAGTGAGGACGATAAACTCGAGTTTATCGTCCTCACTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054078.2-2948s21c1
Sequence:CCGGCTGCTTCCTCATGGCATATAGCTCGAGCTATATGCCATGAGGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054078.2-6422s21c1
Sequence:CCGGCTATCGTGTACGGGTTCTTTACTCGAGTAAAGAACCCGTACACGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054078.2-4357s21c1
Sequence:CCGGAGGTGGAGCAGCATTACTTAACTCGAGTTAAGTAATGCTGCTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054078.2-3486s21c1
Sequence:CCGGAGACGCCATTACTGGGTATTACTCGAGTAATACCCAGTAATGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054078
VALIDATED
BAZ2A MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 2A
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-3281s1c1
Sequence:CCGGGCACAGTTACTGAAGATGAAACTCGAGTTTCATCTTCAGTAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-3904s1c1
Sequence:CCGGGCCTCCTCTAAACCAATGAATCTCGAGATTCATTGGTTTAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-3905s1c1
Sequence:CCGGCCTCCTCTAAACCAATGAATACTCGAGTATTCATTGGTTTAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-1818s1c1
Sequence:CCGGCCGACCTCGAAACAATGAGAACTCGAGTTCTCATTGTTTCGAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-501s1c1
Sequence:CCGGCCAGGATGTAAGCAGTGACATCTCGAGATGTCACTGCTTACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054078.2-2226s21c1
Sequence:CCGGATACTGAGTGAGGACGATAAACTCGAGTTTATCGTCCTCACTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054078.2-2948s21c1
Sequence:CCGGCTGCTTCCTCATGGCATATAGCTCGAGCTATATGCCATGAGGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054078.2-6422s21c1
Sequence:CCGGCTATCGTGTACGGGTTCTTTACTCGAGTAAAGAACCCGTACACGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054078.2-4357s21c1
Sequence:CCGGAGGTGGAGCAGCATTACTTAACTCGAGTTAAGTAATGCTGCTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054078.2-3486s21c1
Sequence:CCGGAGACGCCATTACTGGGTATTACTCGAGTAATACCCAGTAATGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054078
VALIDATED
BAZ2A MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 2A
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075423    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-3281s1c1
Sequence:CCGGGCACAGTTACTGAAGATGAAACTCGAGTTTCATCTTCAGTAACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075427    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-3904s1c1
Sequence:CCGGGCCTCCTCTAAACCAATGAATCTCGAGATTCATTGGTTTAGAGGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-3905s1c1
Sequence:CCGGCCTCCTCTAAACCAATGAATACTCGAGTATTCATTGGTTTAGAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075425    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-1818s1c1
Sequence:CCGGCCGACCTCGAAACAATGAGAACTCGAGTTCTCATTGTTTCGAGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075424    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054078.1-501s1c1
Sequence:CCGGCCAGGATGTAAGCAGTGACATCTCGAGATGTCACTGCTTACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054078.2-2226s21c1
Sequence:CCGGATACTGAGTGAGGACGATAAACTCGAGTTTATCGTCCTCACTCAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054078.2-2948s21c1
Sequence:CCGGCTGCTTCCTCATGGCATATAGCTCGAGCTATATGCCATGAGGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262214    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_054078.2-6422s21c1
Sequence:CCGGCTATCGTGTACGGGTTCTTTACTCGAGTAAAGAACCCGTACACGATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262210    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054078.2-4357s21c1
Sequence:CCGGAGGTGGAGCAGCATTACTTAACTCGAGTTAAGTAATGCTGCTCCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262213    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054078.2-3486s21c1
Sequence:CCGGAGACGCCATTACTGGGTATTACTCGAGTAATACCCAGTAATGGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks