EMAIL THIS PAGE TO A FRIEND

BAZ2B

bromodomain adjacent to zinc finger domain, 2B

190 Gene Product Result for
Synonyms: WALp4
UniProtKB ID: Q9UIF8, D3DPA8, Q96EA1, Q96SQ8, Q9P252, Q9Y4N8
Gene ID:
Mouse(407823) bromodomain adjacent to zinc finger domain, 2B
Rat(317627) bromodomain adjacent to zinc finger domain, 2B
naked mole-rat(101704252) bromodomain adjacent to zinc finger domain, 2B
domestic guinea pig(100718904) bromodomain adjacent to zinc finger domain, 2B
sheep(101111257) bromodomain adjacent to zinc finger domain, 2B
Domestic Rabbit(100356291) bromodomain adjacent to zinc finger domain, 2B
chicken(395400) bromodomain adjacent to zinc finger domain, 2B
dog(478762) bromodomain adjacent to zinc finger domain, 2B
cow(535498) bromodomain adjacent to zinc finger domain, 2B
Horse(100051120) bromodomain adjacent to zinc finger domain, 2B
domestic cat(101093380) bromodomain adjacent to zinc finger domain, 2B
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013450 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013450 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013450 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001001182 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001001182 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001001182 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059611 MISSION® esiRNA esiRNA human BAZ2B (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013450 Rosetta Predictions human pricing
NM_001108260 Rosetta Predictions rat pricing
NM_001001182 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013450 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00344860 predicted 2716
2 SASI_Hs01_00078613 predicted 700
3 SASI_Hs02_00344861 predicted 3798
4 SASI_Hs01_00078617 predicted 5215
5 SASI_Hs02_00344862 predicted 2640
6 SASI_Hs01_00078618 predicted 3706
7 SASI_Hs01_00078619 predicted 3480
8 SASI_Hs02_00344863 predicted 606
9 SASI_Hs01_00078621 predicted 3639
10 SASI_Hs02_00344864 predicted 2891
11 SASI_Hs01_00078612 predicted 3923
12 SASI_Hs01_00078614 predicted 5632
13 SASI_Hs01_00078615 predicted 3526
14 SASI_Hs01_00078616 predicted 807
15 SASI_Hs01_00078620 predicted 1784
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108260 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236904 predicted 3899
2 SASI_Rn02_00236905 predicted 3585
3 SASI_Rn02_00236906 predicted 717
4 SASI_Rn02_00236907 predicted 3970
5 SASI_Rn02_00236908 predicted 2802
6 SASI_Rn02_00236909 predicted 6158
7 SASI_Rn02_00236910 predicted 3749
8 SASI_Rn02_00236911 predicted 1253
9 SASI_Rn02_00236912 predicted 892
10 SASI_Rn02_00236913 predicted 6265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001182 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141070 predicted 5166
2 SASI_Mm01_00141071 predicted 3523
3 SASI_Mm01_00141072 predicted 3585
4 SASI_Mm01_00141073 predicted 5776
5 SASI_Mm01_00141074 predicted 678
6 SASI_Mm01_00141075 predicted 3363
7 SASI_Mm01_00141076 predicted 5354
8 SASI_Mm02_00286092 predicted 5705
9 SASI_Mm01_00141077 predicted 3186
10 SASI_Mm01_00141079 predicted 3510
11 SASI_Mm01_00141078 predicted 1075
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013450
VALIDATED
BAZ2B MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 2B
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013450.2-7034s21c1
Sequence:CCGGCAACCAAGGCCCTCGGTTATTCTCGAGAATAACCGAGGGCCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_013450.2-2650s21c1
Sequence:CCGGTCAAGGAGAAGTAGCATATTACTCGAGTAATATGCTACTTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_013450.2-1220s21c1
Sequence:CCGGGAGAGTGAAGCACAACATAAACTCGAGTTTATGTTGTGCTTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013450.2-1252s21c1
Sequence:CCGGGGTGCTATTACATGGTATTTCCTCGAGGAAATACCATGTAATAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013450.2-4044s21c1
Sequence:CCGGTCGACAAGAACATTGATTATACTCGAGTATAATCAATGTTCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013450.2-1698s21c1
Sequence:CCGGAGAGCCTGAAGAAGGTTATTGCTCGAGCAATAACCTTCTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_013450.1-5422s1c1
Sequence:CCGGCGGAACATTGAAAGAAGAATTCTCGAGAATTCTTCTTTCAATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-1025s1c1
Sequence:CCGGCCTCTGAAGAATCTAGTTTATCTCGAGATAAACTAGATTCTTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-3295s1c1
Sequence:CCGGCGAGACAATGTTTCCGAGATTCTCGAGAATCTCGGAAACATTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-1671s1c1
Sequence:CCGGCCAATCAGAATCAGATAGTAACTCGAGTTACTATCTGATTCTGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-5973s1c1
Sequence:CCGGCCTAGCTCTTTGCAGTATGATCTCGAGATCATACTGCAAAGAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013450
VALIDATED
BAZ2B MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 2B
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013450.2-7034s21c1
Sequence:CCGGCAACCAAGGCCCTCGGTTATTCTCGAGAATAACCGAGGGCCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_013450.2-2650s21c1
Sequence:CCGGTCAAGGAGAAGTAGCATATTACTCGAGTAATATGCTACTTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_013450.2-1220s21c1
Sequence:CCGGGAGAGTGAAGCACAACATAAACTCGAGTTTATGTTGTGCTTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013450.2-1252s21c1
Sequence:CCGGGGTGCTATTACATGGTATTTCCTCGAGGAAATACCATGTAATAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013450.2-4044s21c1
Sequence:CCGGTCGACAAGAACATTGATTATACTCGAGTATAATCAATGTTCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013450.2-1698s21c1
Sequence:CCGGAGAGCCTGAAGAAGGTTATTGCTCGAGCAATAACCTTCTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_013450.1-5422s1c1
Sequence:CCGGCGGAACATTGAAAGAAGAATTCTCGAGAATTCTTCTTTCAATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-1025s1c1
Sequence:CCGGCCTCTGAAGAATCTAGTTTATCTCGAGATAAACTAGATTCTTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-3295s1c1
Sequence:CCGGCGAGACAATGTTTCCGAGATTCTCGAGAATCTCGGAAACATTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-1671s1c1
Sequence:CCGGCCAATCAGAATCAGATAGTAACTCGAGTTACTATCTGATTCTGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-5973s1c1
Sequence:CCGGCCTAGCTCTTTGCAGTATGATCTCGAGATCATACTGCAAAGAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013450
VALIDATED
BAZ2B MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 2B
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013450.2-7034s21c1
Sequence:CCGGCAACCAAGGCCCTCGGTTATTCTCGAGAATAACCGAGGGCCTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_013450.2-2650s21c1
Sequence:CCGGTCAAGGAGAAGTAGCATATTACTCGAGTAATATGCTACTTCTCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 2 Clone ID:NM_013450.2-1220s21c1
Sequence:CCGGGAGAGTGAAGCACAACATAAACTCGAGTTTATGTTGTGCTTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013450.2-1252s21c1
Sequence:CCGGGGTGCTATTACATGGTATTTCCTCGAGGAAATACCATGTAATAGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013450.2-4044s21c1
Sequence:CCGGTCGACAAGAACATTGATTATACTCGAGTATAATCAATGTTCTTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013450.2-1698s21c1
Sequence:CCGGAGAGCCTGAAGAAGGTTATTGCTCGAGCAATAACCTTCTTCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_013450.1-5422s1c1
Sequence:CCGGCGGAACATTGAAAGAAGAATTCTCGAGAATTCTTCTTTCAATGTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019925    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-1025s1c1
Sequence:CCGGCCTCTGAAGAATCTAGTTTATCTCGAGATAAACTAGATTCTTCAGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019926    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-3295s1c1
Sequence:CCGGCGAGACAATGTTTCCGAGATTCTCGAGAATCTCGGAAACATTGTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019927    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-1671s1c1
Sequence:CCGGCCAATCAGAATCAGATAGTAACTCGAGTTACTATCTGATTCTGATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013450.1-5973s1c1
Sequence:CCGGCCTAGCTCTTTGCAGTATGATCTCGAGATCATACTGCAAAGAGCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001182
VALIDATED
BAZ2B MISSION shRNA Bacterial Glycerol Stock
bromodomain adjacent to zinc finger domain, 2B
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000346850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001182.3-7401s21c1
Sequence:CCGGGCATCACTTGTGTAGTTAAATCTCGAGATTTAACTACACAAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001182.3-6449s21c1
Sequence:CCGGCCTGTGAACTTGAAACTCGTACTCGAGTACGAGTTTCAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001182.3-3362s21c1
Sequence:CCGGGTGCAGTTCTTACGAAACTTTCTCGAGAAAGTTTCGTAAGAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000346847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001182.3-1075s21c1
Sequence:CCGGCCAGGTGCTATTACATGGTATCTCGAGATACCATGTAATAGCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001182.2-1075s1c1
Sequence:CCGGCCAGGTGCTATTACATGGTATCTCGAGATACCATGTAATAGCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001182.2-7401s1c1
Sequence:CCGGGCATCACTTGTGTAGTTAAATCTCGAGATTTAACTACACAAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001182.2-6449s1c1
Sequence:CCGGCCTGTGAACTTGAAACTCGTACTCGAGTACGAGTTTCAAGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001182.2-3362s1c1
Sequence:CCGGGTGCAGTTCTTACGAAACTTTCTCGAGAAAGTTTCGTAAGAACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001182
VALIDATED
BAZ2B MISSION shRNA shRNA Plasmid DNA
bromodomain adjacent to zinc finger domain, 2B
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000346850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001182.3-7401s21c1
Sequence:CCGGGCATCACTTGTGTAGTTAAATCTCGAGATTTAACTACACAAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001182.3-6449s21c1
Sequence:CCGGCCTGTGAACTTGAAACTCGTACTCGAGTACGAGTTTCAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001182.3-3362s21c1
Sequence:CCGGGTGCAGTTCTTACGAAACTTTCTCGAGAAAGTTTCGTAAGAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000346847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001182.3-1075s21c1
Sequence:CCGGCCAGGTGCTATTACATGGTATCTCGAGATACCATGTAATAGCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001182.2-1075s1c1
Sequence:CCGGCCAGGTGCTATTACATGGTATCTCGAGATACCATGTAATAGCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001182.2-7401s1c1
Sequence:CCGGGCATCACTTGTGTAGTTAAATCTCGAGATTTAACTACACAAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001182.2-6449s1c1
Sequence:CCGGCCTGTGAACTTGAAACTCGTACTCGAGTACGAGTTTCAAGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001182.2-3362s1c1
Sequence:CCGGGTGCAGTTCTTACGAAACTTTCTCGAGAAAGTTTCGTAAGAACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001182
VALIDATED
BAZ2B MISSION shRNA Lentiviral Transduction Particles
bromodomain adjacent to zinc finger domain, 2B
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000346850    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001001182.3-7401s21c1
Sequence:CCGGGCATCACTTGTGTAGTTAAATCTCGAGATTTAACTACACAAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001182.3-6449s21c1
Sequence:CCGGCCTGTGAACTTGAAACTCGTACTCGAGTACGAGTTTCAAGTTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001182.3-3362s21c1
Sequence:CCGGGTGCAGTTCTTACGAAACTTTCTCGAGAAAGTTTCGTAAGAACTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000346847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001182.3-1075s21c1
Sequence:CCGGCCAGGTGCTATTACATGGTATCTCGAGATACCATGTAATAGCACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001182.2-1075s1c1
Sequence:CCGGCCAGGTGCTATTACATGGTATCTCGAGATACCATGTAATAGCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001182.2-7401s1c1
Sequence:CCGGGCATCACTTGTGTAGTTAAATCTCGAGATTTAACTACACAAGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192271    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_001001182.2-6449s1c1
Sequence:CCGGCCTGTGAACTTGAAACTCGTACTCGAGTACGAGTTTCAAGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001182.2-3362s1c1
Sequence:CCGGGTGCAGTTCTTACGAAACTTTCTCGAGAAAGTTTCGTAAGAACTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks