EMAIL THIS PAGE TO A FRIEND

BBC3

BCL2 binding component 3

164 Gene Product Result for
Synonyms: JFY-1 JFY1 PUMA
UniProtKB ID: Q96PG8
Gene ID:
Human(27113) Summary: This gene encodes a member of the BCL-2 family of proteins. This family member belongs to the BH3-only pro-apoptotic subclass. The protein cooperates with direct activator proteins to induce mitochondrial outer membrane permeabilization and apoptosis. It can bind to anti-apoptotic Bcl-2 family members to induce mitochondrial dysfunction and caspase activation. Because of its pro-apoptotic role, this gene is a potential drug target for cancer therapy and for tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2011]
Mouse(170770) BCL2 binding component 3
Rat(317673) Bcl-2 binding component 3
naked mole-rat(101714844) BCL2 binding component 3
domestic guinea pig(101788977) BCL2 binding component 3
Zebrafish(751763) BCL2 binding component 3
cow(782359) BCL2 binding component 3
dog(612153) BCL2 binding component 3
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501536 Anti-BBC3 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
PRS3043 Anti-PUMA (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1306593 ANTI-PUMA BH3 DOMAIN antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
P4618 Anti-PUMA/bbc3, C-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human
microarray, western blot pricing
P4743 Anti-PUMA/bbc3, N-Terminal antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
microarray, western blot pricing
SAB3500465 Monoclonal Anti-PUMA antibody produced in mouse clone 2A9G5, purified immunoglobulin, buffered aqueous solution rat, human, mouse
ELISA, western blot pricing
SAB3500466 Monoclonal Anti-PUMA antibody produced in mouse clone 10C5G1, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB3500467 Monoclonal Anti-PUMA antibody produced in mouse clone 10D4G7, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing
SAB3500464 Monoclonal Anti-PUMA antibody produced in mouse clone 2A8F6, purified immunoglobulin, buffered aqueous solution human, rat
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133234 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133234 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133234 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014417 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014417 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014417 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001127240 Rosetta Predictions human pricing
NM_001127241 Rosetta Predictions human pricing
NM_001127242 Rosetta Predictions human pricing
NM_014417 Rosetta Predictions human pricing
NM_173837 Rosetta Predictions rat pricing
NM_133234 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127240 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328997 predicted 935
2 SASI_Hs02_00328998 predicted 931
3 SASI_Hs02_00328999 predicted 921
4 SASI_Hs02_00329000 predicted 710
5 SASI_Hs02_00329001 predicted 1310
6 SASI_Hs02_00329002 predicted 1536
7 SASI_Hs02_00329003 predicted 1712
8 SASI_Hs02_00329004 predicted 1538
9 SASI_Hs02_00329005 predicted 1511
10 SASI_Hs02_00329006 predicted 1713
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127241 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329007 predicted 639
2 SASI_Hs02_00329008 predicted 643
3 SASI_Hs02_00329009 predicted 636
4 SASI_Hs02_00329010 predicted 430
5 SASI_Hs02_00329011 predicted 1021
6 SASI_Hs02_00329012 predicted 1252
7 SASI_Hs02_00329013 predicted 1419
8 SASI_Hs02_00329014 predicted 1251
9 SASI_Hs02_00329015 predicted 1223
10 SASI_Hs02_00329016 predicted 1419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127242 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329017 predicted 449
2 SASI_Hs02_00329018 predicted 452
3 SASI_Hs02_00329019 predicted 440
4 SASI_Hs02_00329020 predicted 826
5 SASI_Hs02_00329021 predicted 1059
6 SASI_Hs02_00329022 predicted 1233
7 SASI_Hs02_00329023 predicted 1057
8 SASI_Hs02_00329024 predicted 1030
9 SASI_Hs02_00329025 predicted 1231
10 SASI_Hs02_00329026 predicted 1053
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078524 predicted 942
2 SASI_Hs01_00078529 predicted 953
3 SASI_Hs02_00345610 predicted 943
4 SASI_Hs01_00078523 predicted 730
5 SASI_Hs02_00345611 predicted 1323
6 SASI_Hs02_00345612 predicted 1715
7 SASI_Hs02_00345613 predicted 1555
8 SASI_Hs02_00345614 predicted 1549
9 SASI_Hs02_00345615 predicted 1524
10 SASI_Hs02_00345616 predicted 1722
11 SASI_Hs01_00078522 predicted 791
12 SASI_Hs01_00078525 predicted 710
13 SASI_Hs01_00078526 predicted 712
14 SASI_Hs01_00078527 predicted 789
15 SASI_Hs01_00078528 predicted 704
16 SASI_Hs01_00078530 predicted 711
17 SASI_Hs01_00078531 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120893 predicted 725
2 SASI_Rn01_00120894 predicted 777
3 SASI_Rn01_00120895 predicted 1348
4 SASI_Rn01_00120896 predicted 952
5 SASI_Rn01_00120897 predicted 781
6 SASI_Rn01_00120898 predicted 1352
7 SASI_Rn01_00120899 predicted 726
8 SASI_Rn01_00120900 predicted 1297
9 SASI_Rn01_00120901 predicted 1089
10 SASI_Rn01_00120902 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133234 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00112294 predicted 686
2 SASI_Mm01_00112295 predicted 735
3 SASI_Mm01_00112296 predicted 663
4 SASI_Mm01_00112297 predicted 742
5 SASI_Mm01_00112298 predicted 1049
6 SASI_Mm01_00112299 predicted 904
7 SASI_Mm01_00112300 predicted 655
8 SASI_Mm01_00112301 predicted 681
9 SASI_Mm01_00112302 predicted 809
10 SASI_Mm01_00112303 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133234
VALIDATED
BBC3 MISSION shRNA Bacterial Glycerol Stock
BCL2 binding component 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-801s21c1
Sequence:CCGGCCAGAAATGGAGCCCAACTAGCTCGAGCTAGTTGGGCTCCATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133234.1-1476s21c1
Sequence:CCGGCATCTCATTGCATAGGTTTAGCTCGAGCTAAACCTATGCAATGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-734s21c1
Sequence:CCGGCTCACCCTGGAGGGTCATGTACTCGAGTACATGACCCTCCAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-811s21c1
Sequence:CCGGAGCCCAACTAGGTGCCTACACCTCGAGGTGTAGGCACCTAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-708s21c1
Sequence:CCGGCAAGAAGAGCAGCATCGACACCTCGAGGTGTCGATGCTGCTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133234.1-337s1c1
Sequence:CCGGCCGCTGTATCCTGCAGCCTTTCTCGAGAAAGGCTGCAGGATACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133234.1-743s1c1
Sequence:CCGGGAGGGTCATGTACAATCTCTTCTCGAGAAGAGATTGTACATGACCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133234.1-270s1c1
Sequence:CCGGCCGGAGCCCGTAGAGGGTCTACTCGAGTAGACCCTCTACGGGCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133234.1-755s1c1
Sequence:CCGGCAATCTCTTCATGGGACTCCTCTCGAGAGGAGTCCCATGAAGAGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133234
VALIDATED
BBC3 MISSION shRNA shRNA Plasmid DNA
BCL2 binding component 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-801s21c1
Sequence:CCGGCCAGAAATGGAGCCCAACTAGCTCGAGCTAGTTGGGCTCCATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133234.1-1476s21c1
Sequence:CCGGCATCTCATTGCATAGGTTTAGCTCGAGCTAAACCTATGCAATGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-734s21c1
Sequence:CCGGCTCACCCTGGAGGGTCATGTACTCGAGTACATGACCCTCCAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-811s21c1
Sequence:CCGGAGCCCAACTAGGTGCCTACACCTCGAGGTGTAGGCACCTAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-708s21c1
Sequence:CCGGCAAGAAGAGCAGCATCGACACCTCGAGGTGTCGATGCTGCTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133234.1-337s1c1
Sequence:CCGGCCGCTGTATCCTGCAGCCTTTCTCGAGAAAGGCTGCAGGATACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133234.1-743s1c1
Sequence:CCGGGAGGGTCATGTACAATCTCTTCTCGAGAAGAGATTGTACATGACCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133234.1-270s1c1
Sequence:CCGGCCGGAGCCCGTAGAGGGTCTACTCGAGTAGACCCTCTACGGGCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133234.1-755s1c1
Sequence:CCGGCAATCTCTTCATGGGACTCCTCTCGAGAGGAGTCCCATGAAGAGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133234
VALIDATED
BBC3 MISSION shRNA Lentiviral Transduction Particles
BCL2 binding component 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-801s21c1
Sequence:CCGGCCAGAAATGGAGCCCAACTAGCTCGAGCTAGTTGGGCTCCATTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271166    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133234.1-1476s21c1
Sequence:CCGGCATCTCATTGCATAGGTTTAGCTCGAGCTAAACCTATGCAATGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-734s21c1
Sequence:CCGGCTCACCCTGGAGGGTCATGTACTCGAGTACATGACCCTCCAGGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-811s21c1
Sequence:CCGGAGCCCAACTAGGTGCCTACACCTCGAGGTGTAGGCACCTAGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133234.1-708s21c1
Sequence:CCGGCAAGAAGAGCAGCATCGACACCTCGAGGTGTCGATGCTGCTCTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133234.1-337s1c1
Sequence:CCGGCCGCTGTATCCTGCAGCCTTTCTCGAGAAAGGCTGCAGGATACAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133234.1-743s1c1
Sequence:CCGGGAGGGTCATGTACAATCTCTTCTCGAGAAGAGATTGTACATGACCCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133234.1-270s1c1
Sequence:CCGGCCGGAGCCCGTAGAGGGTCTACTCGAGTAGACCCTCTACGGGCTCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133234.1-755s1c1
Sequence:CCGGCAATCTCTTCATGGGACTCCTCTCGAGAGGAGTCCCATGAAGAGATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014417
VALIDATED
BBC3 MISSION shRNA Bacterial Glycerol Stock
BCL2 binding component 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000033609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014417.2-1318s1c1
Sequence:CCGGCGTGAAGAGCAAATGAGCCAACTCGAGTTGGCTCATTTGCTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_014417.2-785s1c1
Sequence:CCGGGAGGGTCCTGTACAATCTCATCTCGAGATGAGATTGTACAGGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014417.2-553s1c1
Sequence:CCGGACGGTCCTCAGCCCTCGCTCTCTCGAGAGAGCGAGGGCTGAGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014417.2-719s1c1
Sequence:CCGGCGACCTCAACGCACAGTACGACTCGAGTCGTACTGTGCGTTGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014417.2-794s1c1
Sequence:CCGGGTACAATCTCATCATGGGACTCTCGAGAGTCCCATGATGAGATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014417
VALIDATED
BBC3 MISSION shRNA shRNA Plasmid DNA
BCL2 binding component 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000033609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014417.2-1318s1c1
Sequence:CCGGCGTGAAGAGCAAATGAGCCAACTCGAGTTGGCTCATTTGCTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_014417.2-785s1c1
Sequence:CCGGGAGGGTCCTGTACAATCTCATCTCGAGATGAGATTGTACAGGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014417.2-553s1c1
Sequence:CCGGACGGTCCTCAGCCCTCGCTCTCTCGAGAGAGCGAGGGCTGAGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014417.2-719s1c1
Sequence:CCGGCGACCTCAACGCACAGTACGACTCGAGTCGTACTGTGCGTTGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014417.2-794s1c1
Sequence:CCGGGTACAATCTCATCATGGGACTCTCGAGAGTCCCATGATGAGATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014417
VALIDATED
BBC3 MISSION shRNA Lentiviral Transduction Particles
BCL2 binding component 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000033609    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014417.2-1318s1c1
Sequence:CCGGCGTGAAGAGCAAATGAGCCAACTCGAGTTGGCTCATTTGCTCTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1 Clone ID:NM_014417.2-785s1c1
Sequence:CCGGGAGGGTCCTGTACAATCTCATCTCGAGATGAGATTGTACAGGACCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014417.2-553s1c1
Sequence:CCGGACGGTCCTCAGCCCTCGCTCTCTCGAGAGAGCGAGGGCTGAGGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014417.2-719s1c1
Sequence:CCGGCGACCTCAACGCACAGTACGACTCGAGTCGTACTGTGCGTTGAGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A3
TRC Version: 1 Clone ID:NM_014417.2-794s1c1
Sequence:CCGGGTACAATCTCATCATGGGACTCTCGAGAGTCCCATGATGAGATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks