EMAIL THIS PAGE TO A FRIEND

BBOX1

butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1

94 Gene Product Result for
Synonyms: BBH BBOX G-BBH gamma-BBH
UniProtKB ID: O75936, B2R8L7, D3DQZ1, Q6IBJ2
Gene ID:
Human(8424) Summary: This gene encodes gamma butyrobetaine hydroxylase which catalyzes the formation of L-carnitine from gamma-butyrobetaine, the last step in the L-carnitine biosynthetic pathway. Carnitine is essential for the transport of activated fatty acids across the mitochondrial membrane during mitochondrial beta-oxidation. [provided by RefSeq, Jul 2008]
Mouse(170442) butyrobetaine (gamma), 2-oxoglutarate dioxygenase 1 (gamma-butyrobetaine hydroxylase)
Rat(64564) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Zebrafish(572649) butyrobetaine (gamma), 2-oxoglutarate dioxygenase 1 (gamma-butyrobetaine hydroxylase)
chicken(426932) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
cow(507159) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Horse(100072253) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
domestic cat(101082182) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
dog(476894) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
naked mole-rat(101702765) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
domestic guinea pig(100724732) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
sheep(101115823) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Domestic Rabbit(100356171) butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_130452 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_130452 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_130452 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003986 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003986 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003986 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU136061 MISSION® esiRNA esiRNA human BBOX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003986 Rosetta Predictions human pricing
NM_022629 Rosetta Predictions rat pricing
NM_130452 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003986 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092517 predicted 1248
2 SASI_Hs01_00092518 predicted 1583
3 SASI_Hs02_00336686 predicted 459
4 SASI_Hs01_00092519 predicted 1145
5 SASI_Hs01_00092520 predicted 953
6 SASI_Hs02_00336687 predicted 1434
7 SASI_Hs01_00092522 predicted 1045
8 SASI_Hs01_00092523 predicted 1131
9 SASI_Hs01_00092524 predicted 1054
10 SASI_Hs02_00336688 predicted 545
11 SASI_Hs01_00092521 predicted 555
12 SASI_Hs01_00092525 predicted 1202
13 SASI_Hs01_00092526 predicted 1457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022629 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00057317 predicted 787
2 SASI_Rn02_00263417 predicted 917
3 SASI_Rn01_00057318 predicted 676
4 SASI_Rn01_00057319 predicted 775
5 SASI_Rn01_00057320 predicted 399
6 SASI_Rn01_00057321 predicted 212
7 SASI_Rn01_00057323 predicted 463
8 SASI_Rn01_00057324 predicted 561
9 SASI_Rn01_00057325 predicted 812
10 SASI_Rn01_00057326 predicted 884
11 SASI_Rn01_00057322 predicted 437
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_130452 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068964 predicted 1144
2 SASI_Mm01_00068965 predicted 874
3 SASI_Mm01_00068966 predicted 975
4 SASI_Mm01_00068967 predicted 1199
5 SASI_Mm01_00068968 predicted 1289
6 SASI_Mm01_00068969 predicted 868
7 SASI_Mm01_00068970 predicted 901
8 SASI_Mm01_00068971 predicted 652
9 SASI_Mm01_00068972 predicted 1157
10 SASI_Mm01_00068973 predicted 920
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_130452
BBOX1 MISSION shRNA Bacterial Glycerol Stock
butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000076421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-903s1c1
Sequence:CCGGTGTGCAATCTAAACACAAGATCTCGAGATCTTGTGTTTAGATTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-973s1c1
Sequence:CCGGGCAACCAGAGATACAGTCTTTCTCGAGAAAGACTGTATCTCTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130452.1-1402s1c1
Sequence:CCGGCCCTGCAATCATATTCAATATCTCGAGATATTGAATATGATTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-1001s1c1
Sequence:CCGGCCATCGAAAGAGTTCAGCCTTCTCGAGAAGGCTGAACTCTTTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-329s1c1
Sequence:CCGGCCAATGACCATTACAGTGAATCTCGAGATTCACTGTAATGGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_130452
BBOX1 MISSION shRNA shRNA Plasmid DNA
butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000076421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-903s1c1
Sequence:CCGGTGTGCAATCTAAACACAAGATCTCGAGATCTTGTGTTTAGATTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-973s1c1
Sequence:CCGGGCAACCAGAGATACAGTCTTTCTCGAGAAAGACTGTATCTCTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130452.1-1402s1c1
Sequence:CCGGCCCTGCAATCATATTCAATATCTCGAGATATTGAATATGATTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-1001s1c1
Sequence:CCGGCCATCGAAAGAGTTCAGCCTTCTCGAGAAGGCTGAACTCTTTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-329s1c1
Sequence:CCGGCCAATGACCATTACAGTGAATCTCGAGATTCACTGTAATGGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_130452
BBOX1 MISSION shRNA Lentiviral Transduction Particles
butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000076421    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-903s1c1
Sequence:CCGGTGTGCAATCTAAACACAAGATCTCGAGATCTTGTGTTTAGATTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076422    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-973s1c1
Sequence:CCGGGCAACCAGAGATACAGTCTTTCTCGAGAAAGACTGTATCTCTGGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076418    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_130452.1-1402s1c1
Sequence:CCGGCCCTGCAATCATATTCAATATCTCGAGATATTGAATATGATTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076419    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-1001s1c1
Sequence:CCGGCCATCGAAAGAGTTCAGCCTTCTCGAGAAGGCTGAACTCTTTCGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076420    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_130452.1-329s1c1
Sequence:CCGGCCAATGACCATTACAGTGAATCTCGAGATTCACTGTAATGGTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003986
BBOX1 MISSION shRNA Bacterial Glycerol Stock
butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-824s1c1
Sequence:CCGGCCTCTACCTTTGTGGACTTTACTCGAGTAAAGTCCACAAAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-1000s1c1
Sequence:CCGGGCTGCTCTGAAGGAGTTTGTTCTCGAGAACAAACTCCTTCAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-763s1c1
Sequence:CCGGGATGGGTTTAATGTGTGCCAACTCGAGTTGGCACACATTAAACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-301s1c1
Sequence:CCGGCCCGATGAGCATTACAGTGAACTCGAGTTCACTGTAATGCTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-214s1c1
Sequence:CCGGGCACGGAAACTTCTAGTGGAACTCGAGTTCCACTAGAAGTTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003986.2-1486s21c1
Sequence:CCGGTGTCAAGGCTTCGTATCTTAACTCGAGTTAAGATACGAAGCCTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003986.2-1576s21c1
Sequence:CCGGTTGTGAGATATGGCACATTATCTCGAGATAATGTGCCATATCTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003986.2-964s21c1
Sequence:CCGGTAAGCTTTCACACTGATTATCCTCGAGGATAATCAGTGTGAAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003986.2-543s21c1
Sequence:CCGGGATGTGAACATTGGAATTAAACTCGAGTTTAATTCCAATGTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003986
BBOX1 MISSION shRNA shRNA Plasmid DNA
butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-824s1c1
Sequence:CCGGCCTCTACCTTTGTGGACTTTACTCGAGTAAAGTCCACAAAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-1000s1c1
Sequence:CCGGGCTGCTCTGAAGGAGTTTGTTCTCGAGAACAAACTCCTTCAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-763s1c1
Sequence:CCGGGATGGGTTTAATGTGTGCCAACTCGAGTTGGCACACATTAAACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-301s1c1
Sequence:CCGGCCCGATGAGCATTACAGTGAACTCGAGTTCACTGTAATGCTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-214s1c1
Sequence:CCGGGCACGGAAACTTCTAGTGGAACTCGAGTTCCACTAGAAGTTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003986.2-1486s21c1
Sequence:CCGGTGTCAAGGCTTCGTATCTTAACTCGAGTTAAGATACGAAGCCTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003986.2-1576s21c1
Sequence:CCGGTTGTGAGATATGGCACATTATCTCGAGATAATGTGCCATATCTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003986.2-964s21c1
Sequence:CCGGTAAGCTTTCACACTGATTATCCTCGAGGATAATCAGTGTGAAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003986.2-543s21c1
Sequence:CCGGGATGTGAACATTGGAATTAAACTCGAGTTTAATTCCAATGTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003986
BBOX1 MISSION shRNA Lentiviral Transduction Particles
butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-824s1c1
Sequence:CCGGCCTCTACCTTTGTGGACTTTACTCGAGTAAAGTCCACAAAGGTAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-1000s1c1
Sequence:CCGGGCTGCTCTGAAGGAGTTTGTTCTCGAGAACAAACTCCTTCAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-763s1c1
Sequence:CCGGGATGGGTTTAATGTGTGCCAACTCGAGTTGGCACACATTAAACCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064710    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-301s1c1
Sequence:CCGGCCCGATGAGCATTACAGTGAACTCGAGTTCACTGTAATGCTCATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064708    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003986.1-214s1c1
Sequence:CCGGGCACGGAAACTTCTAGTGGAACTCGAGTTCCACTAGAAGTTTCCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432895    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003986.2-1486s21c1
Sequence:CCGGTGTCAAGGCTTCGTATCTTAACTCGAGTTAAGATACGAAGCCTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424016    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003986.2-1576s21c1
Sequence:CCGGTTGTGAGATATGGCACATTATCTCGAGATAATGTGCCATATCTCACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413474    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003986.2-964s21c1
Sequence:CCGGTAAGCTTTCACACTGATTATCCTCGAGGATAATCAGTGTGAAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418721    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003986.2-543s21c1
Sequence:CCGGGATGTGAACATTGGAATTAAACTCGAGTTTAATTCCAATGTTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks